FGF17 cDNA ORF Clone, Human, N-His tag

Cat: HG16126-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All FGF17 Reagents
CRO Services
Product recommended

All FGF17 Reagents
FGF17 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
651 bp
Description
Full length Clone DNA of Human fibroblast growth factor 17 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FGF17 cDNA ORF Clone, Human, N-His tag Alternative Names
FGF-13 cDNA ORF Clone, Human;FGF-17 cDNA ORF Clone, Human;HH20 cDNA ORF Clone, Human
FGF17 Background Information

FGF-13, also known as FGF17, belongs to the fibroblast growth factor (FGF) family. Members of this family show broad mitogenic and cell survival activities, and play a role in a variety of biological processes including embryonic development cell growth, morphogenesis, tissue repair, tumor growth and invasion. FGF-13 is preferentially expressed in the embryonic brain. It interacts with FGFR3 and FGFR4. FGF-13 plays an important role in the regulation of embryonic development and as signaling molecule in the induction and patterning of the embryonic brain. It is also required for normal brain development.

Full Name
fibroblast growth factor 17
References
  • Polnaszek N, et al. (2004) FGF17 is an autocrine prostatic epithelial growth factor and is upregulated in benign prostatic hyperplasia. Prostate. 60(1):18-24.
  • Xu J, et al. (2000) Temporal and spatial gradients of Fgf8 and Fgf17 regulate proliferation and differentiation of midline cerebellar structures. Development. 127(9):1833-43.
  • Strausberg RL, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • FGF17 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    FGF17 cDNA ORF Clone in Cloning Vector, Mouse MG51174-G
    FGF17 cDNA ORF Clone, Mouse, untagged MG51174-UT
    FGF17 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51174-ACGLN
    FGF17 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51174-ACG
    FGF17 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51174-ACR
    FGF17 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51174-CF
    FGF17 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51174-NF
    FGF17 cDNA ORF Clone, Mouse, C-His tag MG51174-CH
    FGF17 cDNA ORF Clone, Mouse, N-His tag MG51174-NH
    FGF17 cDNA ORF Clone, Mouse, C-HA tag MG51174-CY
    FGF17 cDNA ORF Clone, Mouse, N-HA tag MG51174-NY
    FGF17 cDNA ORF Clone, Mouse, C-Myc tag MG51174-CM
    FGF17 cDNA ORF Clone, Mouse, N-Myc tag MG51174-NM

    FGF17 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    FGF17 cDNA ORF Clone in Cloning Vector, Human HG16126-G
    FGF17 cDNA ORF Clone, Human, untagged HG12342-UT
    FGF17 cDNA ORF Clone, Human, untagged HG16126-UT
    FGF17 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16126-ACGLN
    FGF17 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12342-ACGLN
    FGF17 cDNA ORF Clone, Human, C-GFPSpark® tag HG16126-ACG
    FGF17 cDNA ORF Clone, Human, N-GFPSpark® tag HG16126-ANG
    FGF17 cDNA ORF Clone, Human, C-OFPSpark® tag HG16126-ACR
    FGF17 cDNA ORF Clone, Human, N-OFPSpark® tag HG16126-ANR
    FGF17 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16126-CF
    FGF17 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16126-NF
    FGF17 cDNA ORF Clone, Human, C-His tag HG16126-CH
    FGF17 cDNA ORF Clone, Human, C-HA tag HG16126-CY
    FGF17 cDNA ORF Clone, Human, N-HA tag HG16126-NY
    FGF17 cDNA ORF Clone, Human, C-Myc tag HG16126-CM
    FGF17 cDNA ORF Clone, Human, N-Myc tag HG16126-NM
    FGF17 qPCR Primer Pairs, Human HP104712
    info info
    添加购物车成功! 添加购物车失败!