Quick Order

Human FGF-13 / FGF17 Gene ORF cDNA clone expression plasmid, N-Myc tag

    DatasheetReviewsRelated ProductsProtocols
    Human FGF17 cDNA Clone Product Information
    NCBI RefSeq:NM_003867.2
    RefSeq ORF Size:651bp
    cDNA Description:Full length Clone DNA of Homo sapiens fibroblast growth factor 17 with N terminal Myc tag.
    Gene Synonym:HH20, FGF-13
    Species:Human
    Vector:pCMV3-N-Myc
    Plasmid:
    Restriction Site:
    Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with FGF17 qPCR primers for gene expression analysis, HP104712 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Product nameProduct name
    Background

    FGF-13, also known as FGF17, belongs to the fibroblast growth factor (FGF) family. Members of this family show broad mitogenic and cell survival activities, and play a role in a variety of biological processes including embryonic development cell growth, morphogenesis, tissue repair, tumor growth and invasion. FGF-13 is preferentially expressed in the embryonic brain. It interacts with FGFR3 and FGFR4. FGF-13 plays an important role in the regulation of embryonic development and as signaling molecule in the induction and patterning of the embryonic brain. It is also required for normal brain development.

    References
  • Polnaszek N, et al. (2004) FGF17 is an autocrine prostatic epithelial growth factor and is upregulated in benign prostatic hyperplasia. Prostate. 60(1):18-24.
  • Xu J, et al. (2000) Temporal and spatial gradients of Fgf8 and Fgf17 regulate proliferation and differentiation of midline cerebellar structures. Development. 127(9):1833-43.
  • Strausberg RL, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Size / Price
    Catalog: HG16126-NM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"