Quick Order

Human FGF14/SCA27 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Myc tag

    DatasheetReviewsRelated ProductsProtocols
    Human FGF14 cDNA Clone Product Information
    NCBI RefSeq:NM_004115.3
    RefSeq ORF Size:744bp
    cDNA Description:Full length Clone DNA of Homo sapiens fibroblast growth factor 14 with N terminal Myc tag.
    Gene Synonym:FHF4, SCA27, MGC119129, FGF14
    Species:Human
    Vector:pCMV3-N-Myc
    Plasmid:
    Restriction Site:
    Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with FGF14 qPCR primers for gene expression analysis, HP100778 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Human FGF14/SCA27 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Myc tag on other vectors
    Human FGF14/SCA27 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG10893-ACG$225
    Human FGF14/SCA27 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG10893-ACR$225
    Human FGF14/SCA27 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG10893-ANG$225
    Human FGF14/SCA27 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG10893-ANR$225
    Human FGF14/SCA27 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10893-CF$195
    Human FGF14/SCA27 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His tagHG10893-CH$195
    Human FGF14/SCA27 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Myc tagHG10893-CM$195
    Human FGF14/SCA27 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-HA tagHG10893-CY$195
    Human FGF14/SCA27 transcript variant 1 Gene ORF cDNA clone in cloning vectorHG10893-M$75
    Human FGF14/SCA27 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10893-M-F$195
    Human FGF14/SCA27 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Flag tagHG10893-NF$195
    Human FGF14/SCA27 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-His tagHG10893-NH$195
    Human FGF14/SCA27 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Myc tagHG10893-NM$195
    Human FGF14/SCA27 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-HA tagHG10893-NY$195
    Human FGF14/SCA27 transcript variant 1 Gene ORF cDNA clone expression plasmidHG10893-UT$195
     Learn more about expression Vectors
    Product nameProduct name
    Background

    FGF14 is a member of the fibroblast growth factor (FGF) family. Members of this family possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. FGF14 is probably involved in nervous system development and function. Defects in FGF14 are the cause of spinocerebellar ataxia type 27 (SCA27). It is a clinically and genetically heterogeneous group of cerebellar disorders. Patients show progressive incoordination of gait and often poor coordination of hands, speech and eye movements, due to degeneration of the cerebellum with variable involvement of the brainstem and spinal cord. SCA27 is an autosomal dominant cerebellar ataxia. It is a slowly progressive disorder, with onset in late-childhood to early adulthood, characterized by ataxia with tremor, orofacial dyskinesia, psychiatric symptoms and cognitive deficits.

    References
  • Wang Q, et al. (2002) Ataxia and paroxysmal dyskinesia in mice lacking axonally transported FGF14. Neuron. 35 (1): 25-38.
  • Zhao Y, et al. (2007) Genetic analysis of SCA 27 in ataxia and childhood onset postural tremor. Am J Med Genet. 144B (3): 395-6.
  • Lou JY, et al. (2005) Fibroblast growth factor 14 is an intracellular modulator of voltage-gated sodium channels. J Physiol. 569 (1): 179-93.
  • Size / Price
    Catalog: HG10893-NM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"