Text Size:AAA

Human FGF12 / FGF-12 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-His tag

    DatasheetReviewsRelated ProductsProtocols
    Human FGF12 cDNA Clone Product Information
    NCBI RefSeq:NM_004113.4
    RefSeq ORF Size:546bp
    cDNA Description:Full length Clone DNA of Homo sapiens fibroblast growth factor 12, transcript variant 2 with C terminal His tag.
    Gene Synonym:FHF1, FGF12B
    Species:Human
    Vector:pCMV3-C-His
    Plasmid:
    Restriction Site:
    Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with FGF12 qPCR primers for gene expression analysis, HP100355 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Human FGF12 / FGF-12 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-His tag on other vectors
    Human FGF12 / FGF-12 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG10312-ACG$225
    Human FGF12 / FGF-12 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG10312-ACR$225
    Human FGF12 / FGF-12 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG10312-ANG$225
    Human FGF12 / FGF-12 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG10312-ANR$225
    Human FGF12 / FGF-12 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10312-CF$195
    Human FGF12 / FGF-12 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-His tagHG10312-CH$195
    Human FGF12 / FGF-12 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-Myc tagHG10312-CM$195
    Human FGF12 / FGF-12 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-HA tagHG10312-CY$195
    Human FGF12 / FGF-12 transcript variant 2 Gene ORF cDNA clone in cloning vectorHG10312-M$75
    Human FGF12 / FGF-12 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-Flag tagHG10312-NF$195
    Human FGF12 / FGF-12 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-His tagHG10312-NH$195
    Human FGF12 / FGF-12 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-Myc tagHG10312-NM$195
    Human FGF12 / FGF-12 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-HA tagHG10312-NY$195
    Human FGF12 / FGF-12 transcript variant 2 Gene ORF cDNA clone expression plasmidHG10312-UT$195
     Learn more about expression Vectors
    Product nameProduct name
    Background

    FGF12 is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth, and invasion. FGF12 lacks the N-terminal signal sequence present in most of the FGF family members, but it contains clusters of basic residues that have been demonstrated to act as a nuclear localization signal. When transfected into mammalian cells, FGF12 accumulated in the nucleus, but was not secreted. The specific function of FGF12 gene has not yet been determined. Two alternatively spliced transcript variants encoding distinct isoforms have been reported.

    References
  • Liu Y. et al., 1997, Cytogenet Cell Genet. 78 (1): 48-9.
  • Robertson NG. et al., 1995, Genomics. 23 (1): 42-50.
  • Smallwood PM. et al., 1996, Proc Natl Acad Sci. 93 (18): 9850-7.
  • Size / Price
    Catalog: HG10312-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"