FGF10 cDNA ORF Clone, Human, N-HA tag

Cat: HG10573-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All FGF10 Reagents
CRO Services
Product recommended

All FGF10 Reagents
FGF10 cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
603 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human fibroblast growth factor 10 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-HA
Restriction Sites
KpnI + XbaI (6kb + 0.61kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
FGF10 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FGF10 cDNA ORF Clone, Human, N-HA tag Validated Images
Rhesus CD3d/CD3 delta Gene Plasmid Map 5616
FGF10 cDNA ORF Clone, Human, N-HA tag Alternative Names
KGF2 cDNA ORF Clone, Human
FGF10 Background Information

Fibroblast growth factor 10 (FGF10) is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. FGF10 exhibits mitogenic activity for keratinizing epidermal cells, but essentially no activity for fibroblasts, which is similar to the biological activity of FGF7. FGF10 plays an important role in the regulation of embryonic development, cell proliferation and cell differentiation. FGF10 is required for normal branching morphogenesis. It may play a role in wound healing. Defects in FGF10 are the cause of autosomal dominant aplasia of lacrimal and salivary glands (ALSG). ALSG has variable expressivity, and affected individuals may have aplasia or hypoplasia of the lacrimal, parotid, submandibular and sublingual glands and absence of the lacrimal puncta. The disorder is characterized by irritable eyes, recurrent eye infections, epiphora (constant tearing) and xerostomia (dryness of the mouth), which increases the risk of dental erosion, dental caries, periodontal disease and oral infections.

Full Name
fibroblast growth factor 10
References
  • Sekine K, et al. (1999) Fgf10 is essential for limb and lung formation. Nat Genet. 21(1): 138-41.
  • Ohuchi H, et al. (2000) FGF10 acts as a major ligand for FGF receptor 2 IIIb in mouse multi-organ development. Biochem Biophys Res Commun. 277(3): 643-9.
  • Bellusci S, et al. (1997) Fibroblast growth factor 10 (FGF10) and branching morphogenesis in the embryonic mouse lung. Development. 124(23): 4867-78.
  • FGF10 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    FGF10 cDNA ORF Clone in Cloning Vector, Rhesus CG90087-G
    FGF10 cDNA ORF Clone, Rhesus, untagged CG90087-UT
    FGF10 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90087-ACG
    FGF10 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90087-ACGLN
    FGF10 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90087-ACR
    FGF10 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90087-CF
    FGF10 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90087-NF
    FGF10 cDNA ORF Clone, Rhesus, C-His tag CG90087-CH
    FGF10 cDNA ORF Clone, Rhesus, N-His tag CG90087-NH
    FGF10 cDNA ORF Clone, Rhesus, C-HA tag CG90087-CY
    FGF10 cDNA ORF Clone, Rhesus, N-HA tag CG90087-NY
    FGF10 cDNA ORF Clone, Rhesus, C-Myc tag CG90087-CM
    FGF10 cDNA ORF Clone, Rhesus, N-Myc tag CG90087-NM

    FGF10 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    FGF10 cDNA ORF Clone, Rat, untagged RG82712-UT
    FGF10 cDNA ORF Clone, Rat, C-GFPSpark® tag RG82712-ACG
    FGF10 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG82712-ACGLN
    FGF10 cDNA ORF Clone, Rat, C-OFPSpark® tag RG82712-ACR
    FGF10 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG82712-CF
    FGF10 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG82712-NF
    FGF10 cDNA ORF Clone, Rat, C-His tag RG82712-CH
    FGF10 cDNA ORF Clone, Rat, N-His tag RG82712-NH
    FGF10 cDNA ORF Clone, Rat, C-HA tag RG82712-CY
    FGF10 cDNA ORF Clone, Rat, N-HA tag RG82712-NY
    FGF10 cDNA ORF Clone, Rat, C-Myc tag RG82712-CM
    FGF10 cDNA ORF Clone, Rat, N-Myc tag RG82712-NM

    FGF10 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    FGF10 cDNA ORF Clone in Cloning Vector, Mouse MG50196-M
    FGF10 cDNA ORF Clone, Mouse, untagged MG50196-UT
    FGF10 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50196-ACG
    FGF10 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50196-ACGLN
    FGF10 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50196-ACR
    FGF10 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50196-CF
    FGF10 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50196-NF
    FGF10 cDNA ORF Clone, Mouse, C-His tag MG50196-CH
    FGF10 cDNA ORF Clone, Mouse, N-His tag MG50196-NH
    FGF10 cDNA ORF Clone, Mouse, C-HA tag MG50196-CY
    FGF10 cDNA ORF Clone, Mouse, N-HA tag MG50196-NY
    FGF10 cDNA ORF Clone, Mouse, C-Myc tag MG50196-CM
    FGF10 cDNA ORF Clone, Mouse, N-Myc tag MG50196-NM
    FGF10 qPCR Primer Pairs, Mouse MP200226

    FGF10 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    FGF10 cDNA ORF Clone in Cloning Vector, Human HG10573-M
    FGF10 cDNA ORF Clone, Human, untagged HG10573-UT
    FGF10 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10573-ACGLN
    FGF10 cDNA ORF Clone, Human, C-GFPSpark® tag HG10573-ACG
    FGF10 cDNA ORF Clone, Human, C-OFPSpark® tag HG10573-ACR
    FGF10 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10573-CF
    FGF10 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10573-NF
    FGF10 cDNA ORF Clone, Human, C-His tag HG10573-CH
    FGF10 cDNA ORF Clone, Human, N-His tag HG10573-NH
    FGF10 cDNA ORF Clone, Human, C-HA tag HG10573-CY
    FGF10 cDNA ORF Clone, Human, C-Myc tag HG10573-CM
    FGF10 cDNA ORF Clone, Human, N-Myc tag HG10573-NM
    FGF10 qPCR Primer Pairs, Human HP100580
    info info
    添加购物车成功! 添加购物车失败!