Quick Order

Human FES Kinase / Feline sarcoma oncogene ORF mammalian expression plasmid, N-HA tag

DatasheetReviewsRelated ProductsProtocols
Human FES cDNA Clone Product Information
NCBI RefSeq:BC035357
RefSeq ORF Size:2469bp
cDNA Description:Full length Clone DNA of Homo sapiens feline sarcoma oncogene with N terminal HA tag.
Gene Synonym:FPS, FES
Species:Human
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human FES Kinase / Feline sarcoma oncogene ORF mammalian expression plasmid, N-HA tag on other vectors
Product nameProduct name
Background

Proto-oncogene tyrosine-protein kinase Fes/Fps, also known as Proto-oncogene c-Fes, Proto-oncogene c-Fps, Feline sarcoma oncogene, FES and FPS, is a protein which contains one FCH domain, one protein kinase domain and one SH2 domain. FES is a non-receptor protein tyrosine kinase expressed in hematopoietic progenitors and differentiated myeloid cells. FES is observed in the nuclear, granular and plasma membrane fractions of primary human neutrophils and the myeloid leukemia cell line, HL-60. The nuclear localization is confirmed by immunocytochemistry of neutrophils. FES has been implicated in granulocyte-macrophage colony-stimulating factor (GM-CSF), interleukin-3 (IL-3) and erythropoietin signal transduction. FES has tyrosine-specific protein kinase activity and that activity is required for maintenance of cellular transformation. FES is also involved in normal hematopoiesis. Its chromosomal location has linked it to a specific translocation event identified in patients with acute promyelocytic leukemia.

References
  • Bowden DW, et al.,1991, Nucleic acids Res 19 (15): 4311.
  • Yates,K.E. et al., 1995, Oncogene. 10 (6):1239-42.
  • Jücker, M, et al.,1997, J. Biol. Chem.  272 (4): 2104-9.
  • Smithgall,T.E. et al., 1998, Crit Rev Oncog. 9 (1):43-62.
  • Lionberger, et al.,2000, Cancer Res. 60 (4): 1097-103.
  • Size / Price
    Catalog: HG12214-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability
     Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"