Quick Order

Human FES/Feline sarcoma oncogene Gene ORF cDNA clone expression plasmid, N-HA tag

    DatasheetReviewsRelated ProductsProtocols
    Human FES cDNA Clone Product Information
    NCBI RefSeq:BC035357
    RefSeq ORF Size:2469bp
    cDNA Description:Full length Clone DNA of Homo sapiens feline sarcoma oncogene with N terminal HA tag.
    Gene Synonym:FPS, FES
    Species:Human
    Vector:pCMV3-N-HA
    Plasmid:
    Restriction Site:
    Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with FES qPCR primers for gene expression analysis, HP101852 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Product nameProduct name
    Background

    Proto-oncogene tyrosine-protein kinase Fes/Fps, also known as Proto-oncogene c-Fes, Proto-oncogene c-Fps, Feline sarcoma oncogene, FES and FPS, is a protein which contains one FCH domain, one protein kinase domain and one SH2 domain. FES is a non-receptor protein tyrosine kinase expressed in hematopoietic progenitors and differentiated myeloid cells. FES is observed in the nuclear, granular and plasma membrane fractions of primary human neutrophils and the myeloid leukemia cell line, HL-60. The nuclear localization is confirmed by immunocytochemistry of neutrophils. FES has been implicated in granulocyte-macrophage colony-stimulating factor (GM-CSF), interleukin-3 (IL-3) and erythropoietin signal transduction. FES has tyrosine-specific protein kinase activity and that activity is required for maintenance of cellular transformation. FES is also involved in normal hematopoiesis. Its chromosomal location has linked it to a specific translocation event identified in patients with acute promyelocytic leukemia.

    References
  • Bowden DW, et al.,1991, Nucleic acids Res 19 (15): 4311.
  • Yates,K.E. et al., 1995, Oncogene. 10 (6):1239-42.
  • Jücker, M, et al.,1997, J. Biol. Chem.  272 (4): 2104-9.
  • Smithgall,T.E. et al., 1998, Crit Rev Oncog. 9 (1):43-62.
  • Lionberger, et al.,2000, Cancer Res. 60 (4): 1097-103.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"