Kindlin-2 cDNA ORF Clone, Human, untagged

Cat: HG14535-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Kindlin-2 Reagents
CRO Services
Product recommended

All Kindlin-2 Reagents
Kindlin-2 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2043 bp
Description
Full length Clone DNA of Human fermitin family member 2.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Kindlin-2 cDNA ORF Clone, Human, untagged Alternative Names
KIND2 cDNA ORF Clone, Human;mig-2 cDNA ORF Clone, Human;MIG2 cDNA ORF Clone, Human;PLEKHC1 cDNA ORF Clone, Human;UNC112 cDNA ORF Clone, Human;UNC112B cDNA ORF Clone, Human
Kindlin-2 Background Information
Full Name
fermitin family member 2

Kindlin-2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Kindlin-2 cDNA ORF Clone in Cloning Vector, Rat RG81691-G
Kindlin-2 cDNA ORF Clone, Rat, untagged RG81691-UT
Kindlin-2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81691-ACGLN
Kindlin-2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81691-ACG
Kindlin-2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81691-ANG
Kindlin-2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81691-ACR
Kindlin-2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81691-ANR
Kindlin-2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81691-CF
Kindlin-2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81691-NF
Kindlin-2 cDNA ORF Clone, Rat, C-His tag RG81691-CH
Kindlin-2 cDNA ORF Clone, Rat, N-His tag RG81691-NH
Kindlin-2 cDNA ORF Clone, Rat, C-HA tag RG81691-CY
Kindlin-2 cDNA ORF Clone, Rat, N-HA tag RG81691-NY
Kindlin-2 cDNA ORF Clone, Rat, C-Myc tag RG81691-CM
Kindlin-2 cDNA ORF Clone, Rat, N-Myc tag RG81691-NM

Kindlin-2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Kindlin-2 cDNA ORF Clone in Cloning Vector, Human HG14535-G
Kindlin-2 cDNA ORF Clone, Human, C-GFPSpark® tag HG14535-ACG
Kindlin-2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14535-ACGLN
Kindlin-2 cDNA ORF Clone, Human, N-GFPSpark® tag HG14535-ANG
Kindlin-2 cDNA ORF Clone, Human, C-OFPSpark® tag HG14535-ACR
Kindlin-2 cDNA ORF Clone, Human, N-OFPSpark® tag HG14535-ANR
Kindlin-2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14535-CF
Kindlin-2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14535-NF
Kindlin-2 cDNA ORF Clone, Human, C-His tag HG14535-CH
Kindlin-2 cDNA ORF Clone, Human, N-His tag HG14535-NH
Kindlin-2 cDNA ORF Clone, Human, C-HA tag HG14535-CY
Kindlin-2 cDNA ORF Clone, Human, N-HA tag HG14535-NY
Kindlin-2 cDNA ORF Clone, Human, C-Myc tag HG14535-CM
Kindlin-2 cDNA ORF Clone, Human, N-Myc tag HG14535-NM
Kindlin-2 qPCR Primer Pairs, Human HP103182
info info
添加购物车成功! 添加购物车失败!