Quick Order

Human FEM1B Gene ORF cDNA clone expression plasmid

  • Human FEM1B Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
DatasheetReviewsRelated ProductsProtocols
Human FEM1B cDNA Clone Product Information
NCBI RefSeq:NM_015322.3
RefSeq ORF Size:1884bp
cDNA Description:Full length Clone DNA of Homo sapiens fem-1 homolog b (C. elegans).
Gene Synonym:FIAA, DKFZp451E0710, FEM1B
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-FEM1B
Restriction Site:KpnI + XbaI (6.1kb + 1.88kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations 1479 T/C and 1686 C/A not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with FEM1B qPCR primers for gene expression analysis, HP101086 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human FEM1B Gene Plasmid Map
Human FEM1B Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Size / Price
Catalog: HG11180-UT
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability
Add to CartBulk Discount Inquiry

Datasheet & Documentation

Contact Us
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"