Quick Order

Human FEM1B Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human FEM1B cDNA Clone Product Information
NCBI RefSeq:NM_015322.3
RefSeq ORF Size:1884bp
cDNA Description:Full length Clone DNA of Homo sapiens fem-1 homolog b (C. elegans).
Gene Synonym:FIAA, DKFZp451E0710, FEM1B
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-FEM1B
Restriction Site:KpnI + XbaI (6.1kb + 1.88kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations 1479 T/C and 1686 C/A not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human FEM1B Gene Plasmid Map
Human FEM1B Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Size / Price
Catalog: HG11180-UT
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
AvailabilityIn Stock
Bulk Discount InquiryAdd to Cart
Contact Us
Images
  • Human FEM1B Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"