FCRL1 cDNA ORF Clone, Human, N-Myc tag

Cat: HG11536-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All FCRL1 Reagents
CRO Services
Product recommended

All FCRL1 Reagents
FCRL1 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1290 bp
Description
Full length Clone DNA of Human chemokine (C-X-C motif) receptor 7 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FCRL1 cDNA ORF Clone, Human, N-Myc tag Alternative Names
CD307a cDNA ORF Clone, Human;FCRH1 cDNA ORF Clone, Human;IFGP1 cDNA ORF Clone, Human;IRTA5 cDNA ORF Clone, Human
FCRL1 Background Information

Fc receptor-like protein 1, also known as FcR-like protein 1, Fc receptor homolog 1, IFGP family protein 1, Immune receptor translocation-associated protein 5 and FCRL1, is a single-pass type I  membrane protein which contains three Ig-like C2-type (immunoglobulin-like) domains. It is a cell-surface membrane protein belonging to FCRL family and is preferentially expressed on B cells. FCRL1 is primarily expressed in secondary lymphoid tissues by mature subsets of B cells. It is detected in spleen, lymph node, heart, skeletal muscle, kidney, liver and placenta. FCRL1 is specifically expressed by mature B lineage cells with higher expression in naive versus memory B cells (at protein level). Human Fc receptor-like molecules (FCRL1, FCRL2, FCRL3, FCRL4, FCRL5) have tyrosine-based immunoregulatory potential and are expressed by B-lineage subpopulations. FCRL1 may function as an activating coreceptor in B cells. It may also function in B cells activation and differentiation.

Full Name
Fc receptor-like 1
References
  • Du X. et al., 2008, Blood. 111 (1): 338-43.
  • Kazemi T. et al., 2008, Int J Cancer. 123 (9): 2113-9.
  • Baranov K. et al., 2008, J Immunol Methods. 332 (1-2): 73-81.
  • FCRL1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    FCRL1 cDNA ORF Clone in Cloning Vector, Mouse MG50947-G
    FCRL1 cDNA ORF Clone, Mouse, untagged MG50947-UT
    FCRL1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50947-ACGLN
    FCRL1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50947-ACG
    FCRL1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50947-ACR
    FCRL1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50947-CF
    FCRL1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50947-NF
    FCRL1 cDNA ORF Clone, Mouse, C-His tag MG50947-CH
    FCRL1 cDNA ORF Clone, Mouse, N-His tag MG50947-NH
    FCRL1 cDNA ORF Clone, Mouse, C-HA tag MG50947-CY
    FCRL1 cDNA ORF Clone, Mouse, N-HA tag MG50947-NY
    FCRL1 cDNA ORF Clone, Mouse, C-Myc tag MG50947-CM
    FCRL1 cDNA ORF Clone, Mouse, N-Myc tag MG50947-NM
    FCRL1 qPCR Primer Pairs, Mouse MP200916

    FCRL1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    FCRL1 cDNA ORF Clone in Cloning Vector, Human HG11536-M
    FCRL1 cDNA ORF Clone, Human, untagged HG11536-UT
    FCRL1 cDNA ORF Clone, Human, C-GFPSpark® tag HG11536-ACG
    FCRL1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11536-ACGLN
    FCRL1 cDNA ORF Clone, Human, C-OFPSpark® tag HG11536-ACR
    FCRL1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11536-CF
    FCRL1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11536-NF
    FCRL1 cDNA ORF Clone, Human, C-His tag HG11536-CH
    FCRL1 cDNA ORF Clone, Human, N-His tag HG11536-NH
    FCRL1 cDNA ORF Clone, Human, C-HA tag HG11536-CY
    FCRL1 cDNA ORF Clone, Human, N-HA tag HG11536-NY
    FCRL1 cDNA ORF Clone, Human, C-Myc tag HG11536-CM
    FCRL1 qPCR Primer Pairs, Human HP101405
    info info
    添加购物车成功! 添加购物车失败!