After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human FCRL1/FCRH1 Gene ORF cDNA clone expression plasmid, N-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human FCRL1 cDNA Clone Product Information
NCBI RefSeq:NM_052938.4
RefSeq ORF Size:1290bp
cDNA Description:Full length Clone DNA of Homo sapiens chemokine (C-X-C motif) receptor 7 with N terminal Myc tag.
Gene Synonym:FCRH1, IFGP1, IRTA5, DKFZp667O1421, FCRL1
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Fc receptor-like protein 1, also known as FcR-like protein 1, Fc receptor homolog 1, IFGP family protein 1, Immune receptor translocation-associated protein 5 and FCRL1, is a single-pass type I  membrane protein which contains three Ig-like C2-type (immunoglobulin-like) domains. It is a cell-surface membrane protein belonging to FCRL family and is preferentially expressed on B cells. FCRL1 is primarily expressed in secondary lymphoid tissues by mature subsets of B cells. It is detected in spleen, lymph node, heart, skeletal muscle, kidney, liver and placenta. FCRL1 is specifically expressed by mature B lineage cells with higher expression in naive versus memory B cells (at protein level). Human Fc receptor-like molecules (FCRL1, FCRL2, FCRL3, FCRL4, FCRL5) have tyrosine-based immunoregulatory potential and are expressed by B-lineage subpopulations. FCRL1 may function as an activating coreceptor in B cells. It may also function in B cells activation and differentiation.

References
  • Du X. et al., 2008, Blood. 111 (1): 338-43.
  • Kazemi T. et al., 2008, Int J Cancer. 123 (9): 2113-9.
  • Baranov K. et al., 2008, J Immunol Methods. 332 (1-2): 73-81.
  • Size / Price
    Catalog: HG11536-NM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"