After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CD32b/FCGR2B/Fc gamma RIIB transcript variant 3 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human CD32b cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 336 G/A not causing the amino acid variation.
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Human CD32b Gene Plasmid Map
Human FCGR2B / CD32b transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Human CD32b/FCGR2B/Fc gamma RIIB transcript variant 3 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG10259-ACG$225
Human CD32b/FCGR2B/Fc gamma RIIB transcript variant 3 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG10259-ACR$225
Human CD32b/FCGR2B/Fc gamma RIIB transcript variant 3 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10259-CF$195
Human CD32b/FCGR2B/Fc gamma RIIB transcript variant 3 Gene ORF cDNA clone expression plasmid, C-His tagHG10259-CH$195
Human CD32b/FCGR2B/Fc gamma RIIB transcript variant 3 Gene ORF cDNA clone expression plasmid, C-Myc tagHG10259-CM$195
Human CD32b/FCGR2B/Fc gamma RIIB transcript variant 3 Gene ORF cDNA clone expression plasmid, C-HA tagHG10259-CY$195
Human CD32b/FCGR2B/Fc gamma RIIB transcript variant 3 Gene ORF cDNA clone in cloning vectorHG10259-M$75
Human CD32b/FCGR2B/Fc gamma RIIB transcript variant 3 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10259-M-F$195
Human CD32b/FCGR2B/Fc gamma RIIB transcript variant 3 Gene ORF cDNA clone expression plasmid, N-Flag tagHG10259-NF$195
Human CD32b/FCGR2B/Fc gamma RIIB transcript variant 3 Gene ORF cDNA clone expression plasmid, N-His tagHG10259-NH$195
Human CD32b/FCGR2B/Fc gamma RIIB transcript variant 3 Gene ORF cDNA clone expression plasmid, N-Myc tagHG10259-NM$195
Human CD32b/FCGR2B/Fc gamma RIIB transcript variant 3 Gene ORF cDNA clone expression plasmid, N-HA tagHG10259-NY$195
Human CD32b/FCGR2B/Fc gamma RIIB transcript variant 3 Gene ORF cDNA clone expression plasmidHG10259-UT$195
 Learn more about expression Vectors
Product nameProduct name
Contact Us
  • Human FCGR2B / CD32b transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.