CD32A cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10374-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CD32A Reagents
CRO Services
Product recommended

All CD32A Reagents
CD32A cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
954 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 174G/T,600 T/C not causing the amino acid variation.
Description
Full length Clone DNA of Human Fc fragment of IgG, low affinity IIa, receptor (CD32), transcript variant 1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
KpnI + XbaI (6kb + 1kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
CD32A cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD32A cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Human CD32a/FCGR2A/Fc gamma RIIA Gene Expression validated Image 1513
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
other Green fluorescent protein / GFP Gene Plasmid Map 5609
CD32A cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
CD32 cDNA ORF Clone, Human;CD32A cDNA ORF Clone, Human;CDw32 cDNA ORF Clone, Human;Fc gamma RIIA cDNA ORF Clone, Human;FCG2 cDNA ORF Clone, Human;FcGR cDNA ORF Clone, Human;FCGR2 cDNA ORF Clone, Human;FCGR2A1 cDNA ORF Clone, Human;IGFR2 cDNA ORF Clone, Human
CD32A Background Information
Full Name
Fc fragment of IgG receptor IIa

CD32A cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
CD32A cDNA ORF Clone in Cloning Vector, Rhesus CG90016-M
CD32A cDNA ORF Clone, Rhesus, untagged CG90016-UT
CD32A cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90016-ACG
CD32A Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90016-ACGLN
CD32A cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90016-ACR
CD32A cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90016-CF
CD32A cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90016-NF
CD32A cDNA ORF Clone, Rhesus, C-His tag CG90016-CH
CD32A cDNA ORF Clone, Rhesus, N-His tag CG90016-NH
CD32A cDNA ORF Clone, Rhesus, C-HA tag CG90016-CY
CD32A cDNA ORF Clone, Rhesus, N-HA tag CG90016-NY
CD32A cDNA ORF Clone, Rhesus, C-Myc tag CG90016-CM
CD32A cDNA ORF Clone, Rhesus, N-Myc tag CG90016-NM

CD32A cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CD32A cDNA ORF Clone in Cloning Vector, Rat RG80015-M
CD32A cDNA ORF Clone, Rat, untagged RG80015-UT
CD32A cDNA ORF Clone, Rat, C-GFPSpark® tag RG80015-ACG
CD32A Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80015-ACGLN
CD32A cDNA ORF Clone, Rat, C-OFPSpark® tag RG80015-ACR
CD32A cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80015-CF
CD32A cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80015-NF
CD32A cDNA ORF Clone, Rat, C-His tag RG80015-CH
CD32A cDNA ORF Clone, Rat, N-His tag RG80015-NH
CD32A cDNA ORF Clone, Rat, C-HA tag RG80015-CY
CD32A cDNA ORF Clone, Rat, N-HA tag RG80015-NY
CD32A cDNA ORF Clone, Rat, C-Myc tag RG80015-CM
CD32A cDNA ORF Clone, Rat, N-Myc tag RG80015-NM
CD32A qPCR Primer Pairs, Rat RP300014

CD32A cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CD32A cDNA ORF Clone in Cloning Vector, Human HG10374-G
CD32A cDNA ORF Clone, Human, untagged HG10374-UT
CD32A cDNA ORF Clone, Human, C-GFPSpark® tag HG10374-ACG
CD32A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10374-ACGLN
CD32A cDNA ORF Clone, Human, C-OFPSpark® tag HG10374-ACR
CD32A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10374-NF
CD32A cDNA ORF Clone, Human, C-His tag HG10374-CH
CD32A cDNA ORF Clone, Human, N-His tag HG10374-NH
CD32A cDNA ORF Clone, Human, C-HA tag HG10374-CY
CD32A cDNA ORF Clone, Human, N-HA tag HG10374-NY
CD32A cDNA ORF Clone, Human, C-Myc tag HG10374-CM
CD32A cDNA ORF Clone, Human, N-Myc tag HG10374-NM
CD32A qPCR Primer Pairs, Human HP100409
info info
添加购物车成功! 添加购物车失败!