CD23 cDNA ORF Clone, Human, N-His tag

Cat: HG10261-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CD23 Reagents
CRO Services
Product recommended

All CD23 Reagents
CD23 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
966 bp
Description
Full length Clone DNA of Human Fc fragment of IgE, low affinity II, receptor for (FCER2) with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD23 cDNA ORF Clone, Human, N-His tag Alternative Names
BLAST-2 cDNA ORF Clone, Human;CD23 cDNA ORF Clone, Human;CD23A cDNA ORF Clone, Human;CLEC-6 cDNA ORF Clone, Human;CLEC4J cDNA ORF Clone, Human;CLEC6 cDNA ORF Clone, Human;CLECSF8 cDNA ORF Clone, Human;FCE2 cDNA ORF Clone, Human;IGEBF cDNA ORF Clone, Human;MCL cDNA ORF Clone, Human;MGC40078 cDNA ORF Clone, Human;MPCL cDNA ORF Clone, Human
CD23 Background Information

Fc fragment of IgE, low affinity II, receptor for (CD23) or CD23 antigen is a member of the cluster of differentiation family. The cluster of differentiation (cluster of designation) (often abbreviated as CD) is a protocol used for the identification and investigation of cell surface molecules present on white blood cells initially but found in almost any kind of cell of the body, providing targets for immunophenotyping of cells. Physiologically, CD molecules can act in numerous ways, often acting as receptors or ligands (the molecule that activates a receptor) important to the cell. A signal cascade is usually initiated, altering the behavior of the cell (see cell signaling). Some CD proteins do not play a role in cell signaling, but have other functions, such as cell adhesion. CD23/FCER2 is a B-cell specific antigen, and a low-affinity receptor for IgE. It has essential roles in B cell growth and differentiation, and the regulation of IgE production. This protein also exists as a soluble secreted form, then functioning as a potent mitogenic growth factor. Increased levels of soluble CD23/FCER2 cause the recruitment of non-sensitised B-cells in the presentation of antigen peptides to allergen-specific B-cells, therefore increasing the production of allergen specific IgE. IgE, in turn, is known to upregulate the cellular expression of CD23 and Fc epsilon RI (high-affinity IgE receptor).

Full Name
Fc fragment of IgE receptor II
References
  • Aubry JP, et al. (1992) CD21 is a ligand for CD23 and regulates IgE production. Nature. 358(6386): 505-7.
  • Punnonen J, et al. (1993) Interleukin 13 induces interleukin 4-independent IgG4 and IgE synthesis and CD23 expression by human B cells. Proc Natl Acad Sci U S A. 90(8): 3730-4.
  • Yu P, et al. (1994) Negative feedback regulation of IgE synthesis by murine CD23. Nature. 369(6483): 753-6.
  • CD23 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CD23 cDNA ORF Clone in Cloning Vector, Rat RG80208-G
    CD23 cDNA ORF Clone, Rat, untagged RG80208-UT
    CD23 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80208-ACGLN
    CD23 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80208-ACG
    CD23 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80208-ACR
    CD23 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80208-CF
    CD23 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80208-NF
    CD23 cDNA ORF Clone, Rat, C-His tag RG80208-CH
    CD23 cDNA ORF Clone, Rat, N-His tag RG80208-NH
    CD23 cDNA ORF Clone, Rat, C-HA tag RG80208-CY
    CD23 cDNA ORF Clone, Rat, N-HA tag RG80208-NY
    CD23 cDNA ORF Clone, Rat, C-Myc tag RG80208-CM
    CD23 cDNA ORF Clone, Rat, N-Myc tag RG80208-NM
    CD23 qPCR Primer Pairs, Rat RP300200

    CD23 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CD23 cDNA ORF Clone in Cloning Vector, Mouse MG50695-G
    CD23 cDNA ORF Clone, Mouse, untagged MG50695-UT
    CD23 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50695-ACGLN
    CD23 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50695-ACG
    CD23 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50695-ACR
    CD23 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50695-CF
    CD23 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50695-NF
    CD23 cDNA ORF Clone, Mouse, C-His tag MG50695-CH
    CD23 cDNA ORF Clone, Mouse, N-His tag MG50695-NH
    CD23 cDNA ORF Clone, Mouse, C-HA tag MG50695-CY
    CD23 cDNA ORF Clone, Mouse, N-HA tag MG50695-NY
    CD23 cDNA ORF Clone, Mouse, C-Myc tag MG50695-CM
    CD23 cDNA ORF Clone, Mouse, N-Myc tag MG50695-NM
    CD23 qPCR Primer Pairs, Mouse MP200671

    CD23 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CD23 cDNA ORF Clone in Cloning Vector, Human HG10261-M
    CD23 cDNA ORF Clone, Human, untagged HG10261-UT
    CD23 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10261-ACGLN
    CD23 cDNA ORF Clone, Human, C-GFPSpark® tag HG10261-ACG
    CD23 cDNA ORF Clone, Human, C-OFPSpark® tag HG10261-ACR
    CD23 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10261-CF
    CD23 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10261-NF
    CD23 cDNA ORF Clone, Human, C-His tag HG10261-CH
    CD23 cDNA ORF Clone, Human, C-HA tag HG10261-CY
    CD23 cDNA ORF Clone, Human, N-HA tag HG10261-NY
    CD23 cDNA ORF Clone, Human, C-Myc tag HG10261-CM
    CD23 cDNA ORF Clone, Human, N-Myc tag HG10261-NM
    CD23 qPCR Primer Pairs, Human HP100309
    info info
    添加购物车成功! 添加购物车失败!