Quick Order

Human CD23/FCER2 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human CD23 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:Human
Vector:
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 60 T/C not causing the amino acid variation.
Sequencing primers:
Promoter:
Application:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Shipping_carrier:
Storage:
Human CD23 Gene Plasmid Map
Human FCER2 / CD23 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

Fc fragment of IgE, low affinity II, receptor for (CD23) or CD23 antigen is a member of the cluster of differentiation family. The cluster of differentiation (cluster of designation) (often abbreviated as CD) is a protocol used for the identification and investigation of cell surface molecules present on white blood cells initially but found in almost any kind of cell of the body, providing targets for immunophenotyping of cells. Physiologically, CD molecules can act in numerous ways, often acting as receptors or ligands (the molecule that activates a receptor) important to the cell. A signal cascade is usually initiated, altering the behavior of the cell (see cell signaling). Some CD proteins do not play a role in cell signaling, but have other functions, such as cell adhesion. CD23/FCER2 is a B-cell specific antigen, and a low-affinity receptor for IgE. It has essential roles in B cell growth and differentiation, and the regulation of IgE production. This protein also exists as a soluble secreted form, then functioning as a potent mitogenic growth factor. Increased levels of soluble CD23/FCER2 cause the recruitment of non-sensitised B-cells in the presentation of antigen peptides to allergen-specific B-cells, therefore increasing the production of allergen specific IgE. IgE, in turn, is known to upregulate the cellular expression of CD23 and Fc epsilon RI (high-affinity IgE receptor).

References
  • Aubry JP, et al. (1992) CD21 is a ligand for CD23 and regulates IgE production. Nature. 358(6386): 505-7.
  • Punnonen J, et al. (1993) Interleukin 13 induces interleukin 4-independent IgG4 and IgE synthesis and CD23 expression by human B cells. Proc Natl Acad Sci U S A. 90(8): 3730-4.
  • Yu P, et al. (1994) Negative feedback regulation of IgE synthesis by murine CD23. Nature. 369(6483): 753-6.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"