FBXW7 cDNA ORF Clone, Human, C-His tag

Cat: HG13414-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All FBXW7 Reagents
CRO Services
Product recommended

All FBXW7 Reagents
FBXW7 cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2169 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human F-box and WD repeat domain containing 7 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Restriction Sites
KpnI + XbaI(6kb+2.17kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
FBXW7 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FBXW7 cDNA ORF Clone, Human, C-His tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5610
FBXW7 cDNA ORF Clone, Human, C-His tag Alternative Names
AGO cDNA ORF Clone, Human;CDC4 cDNA ORF Clone, Human;FBW6 cDNA ORF Clone, Human;FBW7 cDNA ORF Clone, Human;FBX30 cDNA ORF Clone, Human;FBXO30 cDNA ORF Clone, Human;FBXW6 cDNA ORF Clone, Human;hAgo cDNA ORF Clone, Human;hCdc4 cDNA ORF Clone, Human;SEL-10 cDNA ORF Clone, Human;SEL10 cDNA ORF Clone, Human
FBXW7 Background Information
Full Name
F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase

FBXW7 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
FBXW7 cDNA ORF Clone in Cloning Vector, Human HG13414-G
FBXW7 cDNA ORF Clone in Cloning Vector, Human HG29610-G
FBXW7 cDNA ORF Clone in Cloning Vector, Human HG29625-G
FBXW7 cDNA ORF Clone, Human, untagged HG29625-UT
FBXW7 cDNA ORF Clone, Human, untagged HG13414-UT
FBXW7 cDNA ORF Clone, Human, untagged HG29610-UT
FBXW7 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG29610-ACGLN
FBXW7 cDNA ORF Clone, Human, C-GFPSpark® tag HG29610-ACG
FBXW7 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13414-ACGLN
FBXW7 cDNA ORF Clone, Human, C-GFPSpark® tag HG13414-ACG
FBXW7 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG29625-ACGLN
FBXW7 cDNA ORF Clone, Human, C-GFPSpark® tag HG29625-ACG
FBXW7 cDNA ORF Clone, Human, N-GFPSpark® tag HG29610-ANG
FBXW7 cDNA ORF Clone, Human, N-GFPSpark® tag HG29625-ANG
FBXW7 cDNA ORF Clone, Human, N-GFPSpark® tag HG13414-ANG
FBXW7 cDNA ORF Clone, Human, C-OFPSpark® tag HG13414-ACR
FBXW7 cDNA ORF Clone, Human, C-OFPSpark® tag HG29610-ACR
FBXW7 cDNA ORF Clone, Human, C-OFPSpark® tag HG29625-ACR
FBXW7 cDNA ORF Clone, Human, N-OFPSpark® tag HG13414-ANR
FBXW7 cDNA ORF Clone, Human, N-OFPSpark® tag HG29610-ANR
FBXW7 cDNA ORF Clone, Human, N-OFPSpark® tag HG29625-ANR
FBXW7 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG29610-CF
FBXW7 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG29625-CF
FBXW7 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13414-CF
FBXW7 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG29625-NF
FBXW7 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG29610-NF
FBXW7 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13414-NF
FBXW7 cDNA ORF Clone, Human, C-His tag HG29610-CH
FBXW7 cDNA ORF Clone, Human, C-His tag HG29625-CH
FBXW7 cDNA ORF Clone, Human, N-His tag HG29625-NH
FBXW7 cDNA ORF Clone, Human, N-His tag HG13414-NH
FBXW7 cDNA ORF Clone, Human, N-His tag HG29610-NH
FBXW7 cDNA ORF Clone, Human, C-HA tag HG29610-CY
FBXW7 cDNA ORF Clone, Human, C-HA tag HG13414-CY
FBXW7 cDNA ORF Clone, Human, C-HA tag HG29625-CY
FBXW7 cDNA ORF Clone, Human, N-HA tag HG29625-NY
FBXW7 cDNA ORF Clone, Human, N-HA tag HG29610-NY
FBXW7 cDNA ORF Clone, Human, N-HA tag HG13414-NY
FBXW7 cDNA ORF Clone, Human, C-Myc tag HG29610-CM
FBXW7 cDNA ORF Clone, Human, C-Myc tag HG13414-CM
FBXW7 cDNA ORF Clone, Human, C-Myc tag HG29625-CM
FBXW7 cDNA ORF Clone, Human, N-Myc tag HG13414-NM
FBXW7 cDNA ORF Clone, Human, N-Myc tag HG29625-NM
FBXW7 cDNA ORF Clone, Human, N-Myc tag HG29610-NM
FBXW7 qPCR Primer Pairs, Human HP102116
info info
添加购物车成功! 添加购物车失败!