Fibrillarin cDNA ORF Clone, Human, N-His tag

Cat: HG15495-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Fibrillarin Reagents
CRO Services
Product recommended

All Fibrillarin Reagents
Fibrillarin cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
966 bp
Description
Full length Clone DNA of Human fibrillarin with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Fibrillarin cDNA ORF Clone, Human, N-His tag Alternative Names
FIB cDNA ORF Clone, Human;FLRN cDNA ORF Clone, Human;RNU3IP1 cDNA ORF Clone, Human
Fibrillarin Background Information
Full Name
fibrillarin

Fibrillarin cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Fibrillarin cDNA ORF Clone in Cloning Vector, Mouse MG53664-U
Fibrillarin cDNA ORF Clone, Mouse, untagged MG53664-UT
Fibrillarin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53664-ACG
Fibrillarin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53664-ACGLN
Fibrillarin cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53664-ANG
Fibrillarin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53664-ACR
Fibrillarin cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53664-ANR
Fibrillarin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53664-CF
Fibrillarin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53664-NF
Fibrillarin cDNA ORF Clone, Mouse, C-His tag MG53664-CH
Fibrillarin cDNA ORF Clone, Mouse, N-His tag MG53664-NH
Fibrillarin cDNA ORF Clone, Mouse, C-HA tag MG53664-CY
Fibrillarin cDNA ORF Clone, Mouse, N-HA tag MG53664-NY
Fibrillarin cDNA ORF Clone, Mouse, C-Myc tag MG53664-CM
Fibrillarin cDNA ORF Clone, Mouse, N-Myc tag MG53664-NM

Fibrillarin cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Fibrillarin cDNA ORF Clone in Cloning Vector, Human HG15495-G
Fibrillarin cDNA ORF Clone, Human, untagged HG15495-UT
Fibrillarin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15495-ACGLN
Fibrillarin cDNA ORF Clone, Human, C-GFPSpark® tag HG15495-ACG
Fibrillarin cDNA ORF Clone, Human, N-GFPSpark® tag HG15495-ANG
Fibrillarin cDNA ORF Clone, Human, C-OFPSpark® tag HG15495-ACR
Fibrillarin cDNA ORF Clone, Human, N-OFPSpark® tag HG15495-ANR
Fibrillarin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15495-CF
Fibrillarin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15495-NF
Fibrillarin cDNA ORF Clone, Human, C-His tag HG15495-CH
Fibrillarin cDNA ORF Clone, Human, C-HA tag HG15495-CY
Fibrillarin cDNA ORF Clone, Human, N-HA tag HG15495-NY
Fibrillarin cDNA ORF Clone, Human, C-Myc tag HG15495-CM
Fibrillarin cDNA ORF Clone, Human, N-Myc tag HG15495-NM
Fibrillarin qPCR Primer Pairs, Human HP104117
info info
添加购物车成功! 添加购物车失败!