Quick Order

Human Fatty Acid Synthase Gene ORF cDNA clone expression plasmid, N-His tag

  • Ferret TNF-alpha/TNFA/TNFSF2 Gene Plasmid Map 5629
DatasheetReviewsRelated ProductsProtocols
Human FASN cDNA Clone Product Information
NCBI RefSeq:BC007909
RefSeq ORF Size:1365 bp
cDNA Description:Full length Clone DNA of Homo sapiens fatty acid synthase with N terminal His tag.
Gene Synonym:FAS, OA-519, SDR27X1, FASN
Species:Human
Vector:pCMV3-N-His
Plasmid:pCMV3-His-FASN
Restriction Site:KpnI + XbaI(6kb+1.37kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with FASN qPCR primers for gene expression analysis, HP101917 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"