FANCL cDNA ORF Clone, Human, C-HA tag

Cat: HG10520-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All FANCL Reagents
CRO Services
Product recommended

All FANCL Reagents
FANCL cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1128 bp
Description
Full length Clone DNA of Human Fanconi anemia, complementation group L with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FANCL cDNA ORF Clone, Human, C-HA tag Alternative Names
FAAP43 cDNA ORF Clone, Human;PHF9 cDNA ORF Clone, Human;POG cDNA ORF Clone, Human
FANCL Background Information
Full Name
Fanconi anemia, complementation group L

FANCL cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
FANCL cDNA ORF Clone in Cloning Vector, Mouse MG50781-G
FANCL cDNA ORF Clone, Mouse, untagged MG50781-UT
FANCL Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50781-ACGLN
FANCL cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50781-ACG
FANCL cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50781-ANG
FANCL cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50781-ACR
FANCL cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50781-ANR
FANCL cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50781-CF
FANCL cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50781-NF
FANCL cDNA ORF Clone, Mouse, C-His tag MG50781-CH
FANCL cDNA ORF Clone, Mouse, N-His tag MG50781-NH
FANCL cDNA ORF Clone, Mouse, C-HA tag MG50781-CY
FANCL cDNA ORF Clone, Mouse, N-HA tag MG50781-NY
FANCL cDNA ORF Clone, Mouse, C-Myc tag MG50781-CM
FANCL cDNA ORF Clone, Mouse, N-Myc tag MG50781-NM
FANCL qPCR Primer Pairs, Mouse MP200755

FANCL cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
FANCL cDNA ORF Clone in Cloning Vector, Human HG10520-M
FANCL cDNA ORF Clone, Human, untagged HG10520-UT
FANCL cDNA ORF Clone, Human, C-GFPSpark® tag HG10520-ACG
FANCL Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10520-ACGLN
FANCL cDNA ORF Clone, Human, N-GFPSpark® tag HG10520-ANG
FANCL cDNA ORF Clone, Human, C-OFPSpark® tag HG10520-ACR
FANCL cDNA ORF Clone, Human, N-OFPSpark® tag HG10520-ANR
FANCL cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10520-CF
FANCL cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10520-NF
FANCL cDNA ORF Clone, Human, C-His tag HG10520-CH
FANCL cDNA ORF Clone, Human, N-His tag HG10520-NH
FANCL cDNA ORF Clone, Human, N-HA tag HG10520-NY
FANCL cDNA ORF Clone, Human, C-Myc tag HG10520-CM
FANCL cDNA ORF Clone, Human, N-Myc tag HG10520-NM
FANCL qPCR Primer Pairs, Human HP100537
info info
添加购物车成功! 添加购物车失败!