FAM60A cDNA ORF Clone, Human, C-His tag

Cat: HG16431-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All FAM60A Reagents
CRO Services
Product recommended

All FAM60A Reagents
FAM60A cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
666 bp
Description
Full length Clone DNA of Human family with sequence similarity 60, member A with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FAM60A cDNA ORF Clone, Human, C-His tag Alternative Names
C12orf14 cDNA ORF Clone, Human;L4 cDNA ORF Clone, Human;TERA cDNA ORF Clone, Human
FAM60A Background Information
Full Name
family with sequence similarity 60, member A

FAM60A cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
FAM60A cDNA ORF Clone in Cloning Vector, Mouse MG5A3991-U
FAM60A cDNA ORF Clone, Mouse, untagged MG5A3991-UT
FAM60A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A3991-ACG
FAM60A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A3991-ACGLN
FAM60A cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A3991-ANG
FAM60A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A3991-ACR
FAM60A cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A3991-ANR
FAM60A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A3991-CF
FAM60A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A3991-NF
FAM60A cDNA ORF Clone, Mouse, C-His tag MG5A3991-CH
FAM60A cDNA ORF Clone, Mouse, N-His tag MG5A3991-NH
FAM60A cDNA ORF Clone, Mouse, C-HA tag MG5A3991-CY
FAM60A cDNA ORF Clone, Mouse, N-HA tag MG5A3991-NY
FAM60A cDNA ORF Clone, Mouse, C-Myc tag MG5A3991-CM
FAM60A cDNA ORF Clone, Mouse, N-Myc tag MG5A3991-NM

FAM60A cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
FAM60A cDNA ORF Clone in Cloning Vector, Human HG16431-G
FAM60A cDNA ORF Clone, Human, untagged HG16431-UT
FAM60A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16431-ACGLN
FAM60A cDNA ORF Clone, Human, C-GFPSpark® tag HG16431-ACG
FAM60A cDNA ORF Clone, Human, N-GFPSpark® tag HG16431-ANG
FAM60A cDNA ORF Clone, Human, C-OFPSpark® tag HG16431-ACR
FAM60A cDNA ORF Clone, Human, N-OFPSpark® tag HG16431-ANR
FAM60A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16431-CF
FAM60A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16431-NF
FAM60A cDNA ORF Clone, Human, N-His tag HG16431-NH
FAM60A cDNA ORF Clone, Human, C-HA tag HG16431-CY
FAM60A cDNA ORF Clone, Human, N-HA tag HG16431-NY
FAM60A cDNA ORF Clone, Human, C-Myc tag HG16431-CM
FAM60A cDNA ORF Clone, Human, N-Myc tag HG16431-NM
FAM60A qPCR Primer Pairs, Human HP105180
info info
添加购物车成功! 添加购物车失败!