FAM3D cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG11659-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All FAM3D Reagents
CRO Services
Product recommended

All FAM3D Reagents
FAM3D cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
675 bp
Description
Full length Clone DNA of Human family with sequence similarity 3, member D with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FAM3D cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
EF7 cDNA ORF Clone, Human;OIT1 cDNA ORF Clone, Human;UNQ567/PRO1130 cDNA ORF Clone, Human
FAM3D Background Information

Family with sequence similarity 3 (FAM3) family is a novel cytokine-like gene family, which has four genes in this family, FAM3A, FAM3B, FAM3C, and FAM3D, each encoding a protein (224-235 amino acids) with a hydrophobic leader sequence. It had indicated that FAM3B/PANDER (pancreatic derived factor) is highly expressed in pancreas, and FAM3A and FAM3C in almost all tissues. FAM3D is abundantly expressed in placenta and weakly expressed in small intestine. Immunohistochemistry showed that FAM3A is expressed prominently in the vascular endothelium, particularly capillaries. FAM3A and FAM3B protein were both localized to the islets of Langerhans of the endocrine pancreas. Recombinant FAM3B protein has delayed effects on beta-cell function. FAM3C is involved in retinal laminar formation processes in vertebrates. NFATC2, SCP2, CACNA1C, TCRA, POLE, and FAM3D, were associated with narcolepsy. Some of these associations were further supported by gene expression analyses and an association study in essential hypersomnia (EHS), CNS hypersonia similar to narcolepsy.

Full Name
family with sequence similarity 3 member D
References
  • Zhu Y, et al. (2002) Cloning, expression, and initial characterization of a novel cytokine-like gene family. Genomics. 80(2): 144-50.
  • Katahira T, et al. (2010) Secreted factor FAM3C (ILEI) is involved in retinal laminar formation. Biochem Biophys Res Commun. 392(3): 301-6.
  • Shimada M, et al. (2010) An approach based on a genome-wide association study reveals candidate loci for narcolepsy. Hum Genet. 128(4): 433-41.
  • FAM3D cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    FAM3D cDNA ORF Clone in Cloning Vector, Mouse MG50951-G
    FAM3D cDNA ORF Clone, Mouse, untagged MG50951-UT
    FAM3D Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50951-ACGLN
    FAM3D cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50951-ACG
    FAM3D cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50951-ACR
    FAM3D cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50951-CF
    FAM3D cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50951-NF
    FAM3D cDNA ORF Clone, Mouse, C-His tag MG50951-CH
    FAM3D cDNA ORF Clone, Mouse, N-His tag MG50951-NH
    FAM3D cDNA ORF Clone, Mouse, C-HA tag MG50951-CY
    FAM3D cDNA ORF Clone, Mouse, N-HA tag MG50951-NY
    FAM3D cDNA ORF Clone, Mouse, C-Myc tag MG50951-CM
    FAM3D cDNA ORF Clone, Mouse, N-Myc tag MG50951-NM
    FAM3D qPCR Primer Pairs, Mouse MP200920

    FAM3D cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    FAM3D cDNA ORF Clone in Cloning Vector, Human HG11659-M
    FAM3D cDNA ORF Clone, Human, untagged HG11659-UT
    FAM3D Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11659-ACGLN
    FAM3D cDNA ORF Clone, Human, C-GFPSpark® tag HG11659-ACG
    FAM3D cDNA ORF Clone, Human, C-OFPSpark® tag HG11659-ACR
    FAM3D cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11659-NF
    FAM3D cDNA ORF Clone, Human, C-His tag HG11659-CH
    FAM3D cDNA ORF Clone, Human, N-His tag HG11659-NH
    FAM3D cDNA ORF Clone, Human, C-HA tag HG11659-CY
    FAM3D cDNA ORF Clone, Human, N-HA tag HG11659-NY
    FAM3D cDNA ORF Clone, Human, C-Myc tag HG11659-CM
    FAM3D cDNA ORF Clone, Human, N-Myc tag HG11659-NM
    FAM3D qPCR Primer Pairs, Human HP101504
    info info
    添加购物车成功! 添加购物车失败!