FAM3B cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG11338-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All FAM3B Reagents
CRO Services
Product recommended

All FAM3B Reagents
FAM3B cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
708 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 396T/C not causing the amino acid variation.
Description
Full length Clone DNA of Human family with sequence similarity 3, member B with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Restriction Sites
KpnI + XbaI(6kb+0.71kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
FAM3B cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FAM3B cDNA ORF Clone, Human, N-DDK (Flag®) tag Validated Images
Rhesus CD64/Fc gamma RI Gene Plasmid Map 5614
FAM3B cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
42056 cDNA ORF Clone, Human;C21orf11 cDNA ORF Clone, Human;C21orf76 cDNA ORF Clone, Human;ORF9 cDNA ORF Clone, Human;PANDER cDNA ORF Clone, Human;PRED44 cDNA ORF Clone, Human
FAM3B Background Information

Pancreatic derived factor, also known as FAM3B, is an islet-specific secreted cytokine specifically expressed at high levels in the islets of Langerhans of the endocrine pancreas. FAM3B protein is present in alpha- and beta- cells of pancreatic islets, insulin-secreting beta-TC3 cells, and glucagon-secreting alpha-TC cells. FAM3B causes apoptosis of beta-cells as assessed by electron microscopy, annexin Ⅴ fluorescent staining, and flow-cytometric terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling assay. FAM3B activated caspase-3 while not affect cytosolic Ca2+ levels or nitric oxide levels. Hense, FAM3B may have a role in the process of pancreatic?-cell apoptosis of primary islet and cell lines. FAM3B secretion is regulated by glucose and other insulin secretagogues. This islet-specific secreted cytokine is secreted from both pancreatic alpha- and beta- cells. Glucose stimulates FAM3B secretion dose dependently in beta- cell lines and primary islets but not in alpha-cells. It is likely cosecreted with insulin via the same regulatory mechanisms and structure and conformation is vital for FAM3B secretion.

Full Name
family with sequence similarity 3, member B
References
  • Cao X, et al. (2003) Pancreatic-derived factor (FAM3B), a novel islet cytokine, induces apoptosis of insulin-secreting beta-cells. Diabetes. 52(9): 2296-303.
  • Yang J, et al. (2005) Mechanisms of glucose-induced secretion of pancreatic-derived factor (PANDER or FAM3B) in pancreatic beta-cells. Diabetes. 54(11): 3217-28.
  • Xu W, et al. (2005) Interferon-gamma-induced regulation of the pancreatic derived cytokine FAM3B in islets and insulin-secreting betaTC3 cells. Mol Cell Endocrinol. 240(1-2): 74-81.
  • info info
    添加购物车成功! 添加购物车失败!