NIP30 cDNA ORF Clone, Human, C-His tag

Cat: HG16370-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All NIP30 Reagents
CRO Services
Product recommended

All NIP30 Reagents
NIP30 cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
765 bp
Description
Full length Clone DNA of Human family with sequence similarity 192, member A with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NIP30 cDNA ORF Clone, Human, C-His tag Alternative Names
C16orf94 cDNA ORF Clone, Human;CDA018 cDNA ORF Clone, Human;CDA10 cDNA ORF Clone, Human;NIP30 cDNA ORF Clone, Human
NIP30 Background Information
Full Name
family with sequence similarity 192, member A

NIP30 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
NIP30 cDNA ORF Clone in Cloning Vector, Rat RG8A6892-U
NIP30 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A6892-ACGLN

NIP30 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
NIP30 cDNA ORF Clone in Cloning Vector, Mouse MG51975-U
NIP30 cDNA ORF Clone, Mouse, untagged MG51975-UT
NIP30 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51975-ACGLN
NIP30 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51975-ACG
NIP30 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51975-ANG
NIP30 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51975-ACR
NIP30 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51975-ANR
NIP30 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51975-CF
NIP30 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51975-NF
NIP30 cDNA ORF Clone, Mouse, C-His tag MG51975-CH
NIP30 cDNA ORF Clone, Mouse, N-His tag MG51975-NH
NIP30 cDNA ORF Clone, Mouse, C-HA tag MG51975-CY
NIP30 cDNA ORF Clone, Mouse, N-HA tag MG51975-NY
NIP30 cDNA ORF Clone, Mouse, C-Myc tag MG51975-CM
NIP30 cDNA ORF Clone, Mouse, N-Myc tag MG51975-NM
NIP30 qPCR Primer Pairs, Mouse MP201848

NIP30 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
NIP30 cDNA ORF Clone in Cloning Vector, Human HG16370-G
NIP30 cDNA ORF Clone, Human, untagged HG16370-UT
NIP30 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16370-ACGLN
NIP30 cDNA ORF Clone, Human, C-GFPSpark® tag HG16370-ACG
NIP30 cDNA ORF Clone, Human, N-GFPSpark® tag HG16370-ANG
NIP30 cDNA ORF Clone, Human, C-OFPSpark® tag HG16370-ACR
NIP30 cDNA ORF Clone, Human, N-OFPSpark® tag HG16370-ANR
NIP30 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16370-CF
NIP30 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16370-NF
NIP30 cDNA ORF Clone, Human, N-His tag HG16370-NH
NIP30 cDNA ORF Clone, Human, C-HA tag HG16370-CY
NIP30 cDNA ORF Clone, Human, N-HA tag HG16370-NY
NIP30 cDNA ORF Clone, Human, C-Myc tag HG16370-CM
NIP30 cDNA ORF Clone, Human, N-Myc tag HG16370-NM
NIP30 qPCR Primer Pairs, Human HP105120
info info
添加购物车成功! 添加购物车失败!