FABP2 cDNA ORF Clone, Human, N-His tag

Cat: HG10130-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All FABP2 Reagents
CRO Services
Product recommended

All FABP2 Reagents
FABP2 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
399 bp
Description
Full length Clone DNA of Human fatty acid binding protein 2, intestinal (FABP2) with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FABP2 cDNA ORF Clone, Human, N-His tag Alternative Names
FABPI cDNA ORF Clone, Human;I-FABP cDNA ORF Clone, Human;MGC133132 cDNA ORF Clone, Human
FABP2 Background Information

Fatty acid binding protein (FABP) is one of the intracellular proteins, with a low molecular weight of approximately 15 kDa, that plays important roles in the transportation and metabolism of long-chain fatty acids. FABP family proteins could be used as tissue specific injury marker based on the following characteristics of FABP. The intestinal fatty acid binding protein (I-FABP), or fatty acid-binding protein 2 (FABP2), an intracellular protein expressed only in the intestine, involved in the absorption and intracellular transport of dietary long chain fatty acids. The FABP2 gene is proposed as a candidate gene for diabetes because the protein it codes is involved in fatty acid (FA) absorption and metabolism. Numerous studies have assessed FABP2 gene variants. A transition of G to A at codon 54 of FABP2 results in an amino acid substitution (Ala54 to Thr54), which is common in diverse populations and results in increased FA absorption in vivo. Some evidence indicates that this variant may be associated with type 2 diabetes. This polymorphism was associated with some cardiovascular risk factors. The cytosolic human intestinal fatty acid binding protein (hFABP2) is proposed to be involved in intestinal absorption of long-chain fatty acids. FABP2 may also help maintain energy homeostasis by functioning as a lipid sensor.

Full Name
fatty acid binding protein 2
References
  • de Luis DA, et al. (2007) Influence of ALA54THR polymorphism of fatty acid-binding protein 2 on obesity and cardiovascular risk factors. Horm Metab Res. 39(11): 830-4.
  • Klapper M, et al.. (2007) The human intestinal fatty acid binding protein (hFABP2) gene is regulated by HNF-4alpha. Biochem Biophys Res Commun. 356(1): 147-52.
  • FABP2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    FABP2 cDNA ORF Clone, Mouse, untagged MG58680-UT
    FABP2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58680-ACG
    FABP2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58680-ACGLN
    FABP2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG58680-ANG
    FABP2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG58680-ACR
    FABP2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG58680-ANR
    FABP2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG58680-CF
    FABP2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG58680-NF
    FABP2 cDNA ORF Clone, Mouse, C-His tag MG58680-CH
    FABP2 cDNA ORF Clone, Mouse, N-His tag MG58680-NH
    FABP2 cDNA ORF Clone, Mouse, C-HA tag MG58680-CY
    FABP2 cDNA ORF Clone, Mouse, N-HA tag MG58680-NY
    FABP2 cDNA ORF Clone, Mouse, C-Myc tag MG58680-CM
    FABP2 cDNA ORF Clone, Mouse, N-Myc tag MG58680-NM

    FABP2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    FABP2 cDNA ORF Clone in Cloning Vector, Human HG10130-M
    FABP2 cDNA ORF Clone, Human, untagged HG10130-UT
    FABP2 cDNA ORF Clone, Human, C-GFPSpark® tag HG10130-ACG
    FABP2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10130-ACGLN
    FABP2 cDNA ORF Clone, Human, N-GFPSpark® tag HG10130-ANG
    FABP2 cDNA ORF Clone, Human, C-OFPSpark® tag HG10130-ACR
    FABP2 cDNA ORF Clone, Human, N-OFPSpark® tag HG10130-ANR
    FABP2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10130-CF
    FABP2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10130-NF
    FABP2 cDNA ORF Clone, Human, C-His tag HG10130-CH
    FABP2 cDNA ORF Clone, Human, C-HA tag HG10130-CY
    FABP2 cDNA ORF Clone, Human, N-HA tag HG10130-NY
    FABP2 cDNA ORF Clone, Human, C-Myc tag HG10130-CM
    FABP2 cDNA ORF Clone, Human, N-Myc tag HG10130-NM
    FABP2 qPCR Primer Pairs, Human HP100202
    info info
    添加购物车成功! 添加购物车失败!