Quick Order

Human Coagulation Factor IX / FIX / F9 Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human F9 cDNA Clone Product Information
NCBI RefSeq:NM_000133.3
RefSeq ORF Size:1386bp
cDNA Description:Full length Clone DNA of Homo sapiens coagulation factor IX with N terminal His tag.
Gene Synonym:FIX, PTC, HEMB, MGC129641, MGC129642, F9
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Coagulation factor IX, also known as Christmas factor, Plasma thromboplastin component and PTC, is a secreted protein which belongs to the peptidase S1 family. Coagulation factor IX / F9 contains two EGF-like domains, one Gla (gamma-carboxy-glutamate) domain and one?peptidase S1 domain. Coagulation factor IX / F9 is a vitamin K-dependent plasma protein that participates in the intrinsic pathway of blood coagulation by converting factor X to its active form in the presence of Ca2+ons, phospholipids, and factor VIIIa. Defects in Coagulation factor IX / F9 are the cause of thrombophilia due to factor IX defect which is a hemostatic disorder characterized by a tendency to thrombosis. Defects in Coagulation factor IX / F9 are also the cause of recessive X-linked hemophilia B ( HEMB ) which also known as Christmas disease.

References
  • Onay U.V., et al., 2003, Br. J. Haematol. 120:656-659.
  • Vidal F., et al., 2000, Br. J. Haematol. 111:549-551.
  • Simioni P., et al., 2009, N. Engl. J. Med. 361:1671-1675.
  • Espinos C., et al., 2009, Haematologica 88:235-236.
  • Size / Price
    Catalog: HG11503-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"