Factor XIII cDNA ORF Clone, Human, N-Myc tag

Cat: HG11510-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Factor XIII Reagents
CRO Services
Product recommended

All Factor XIII Reagents
Factor XIII cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1986 bp
Description
Full length Clone DNA of Human coagulation factor XIII, B polypeptide with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Factor XIII cDNA ORF Clone, Human, N-Myc tag Alternative Names
Coagulation factor 13 cDNA ORF Clone, Human;Coagulation factor XIII cDNA ORF Clone, Human;FXIIIB cDNA ORF Clone, Human
Factor XIII Background Information

Coagulation factor XIII B chain, also known as Fibrin-stabilizing factor B subunit, Protein-glutamine gamma-glutamyltransferase B chain, Transglutaminase B chain and F13B, is a secreted protein which contains 10 Sushi ( CCP / SCR ) domains. Coagulation factor XIII is the last zymogen to become activated in the blood coagulation cascade. Plasma factor XIII is a heterotetramer composed of 2 A subunits and 2 B subunits. The A subunits have catalytic function, and the B subunits do not have enzymatic activity and may serve as a plasma carrier molecules. Platelet factor XIII is composed of just 2 A subunits, which are identical to those of plasma origin. The B chain of factor XIII is not catalytically active, but is thought to stabilize the A subunits and regulate the rate of transglutaminase formation by thrombin. Factor XIII acts as a transglutaminase to catalyze the formation of gamma-glutamyl-epsilon-lysine crosslinking between fibrin molecules, thus stabilizing the fibrin clot. Factor XIII deficiency is classified into two categories: type I deficiency, characterized by the lack of both the A and B subunits; and type II deficiency, characterized by the lack of the A subunit alone. These defects can result in a lifelong bleeding tendency, defective wound healing, and habitual abortion. Defects in F13B are the cause of factor XIII subunit B deficiency ( FA13BD ) which is an autosomal recessive disorder characterized by a life-long bleeding tendency, impaired wound healing and spontaneous abortion in affected women.

Full Name
coagulation factor XIII, B polypeptide
References
  • Bottenus R.E., et al.,(1990), Nucleotide sequence of the gene for the b subunit of human factor XIII. Biochemistry 29:11195-11209.
  • Ichinose A., et al., (1986), Amino acid sequence of the b subunit of human factor XIII, a protein composed of ten repetitive segments.Biochemistry 25:4633-4638.
  • Ota T., et al.,(2004), Complete sequencing and characterization of 21,243 full-length human cDNAs.Nat. Genet. 36:40-45.
  • Factor XIII cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Factor XIII cDNA ORF Clone in Cloning Vector, Mouse MG5A3395-U
    Factor XIII cDNA ORF Clone, Mouse, untagged MG5A3395-UT
    Factor XIII Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A3395-ACGLN
    Factor XIII cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A3395-ACG
    Factor XIII cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A3395-ACR
    Factor XIII cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A3395-CF
    Factor XIII cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A3395-NF
    Factor XIII cDNA ORF Clone, Mouse, C-His tag MG5A3395-CH
    Factor XIII cDNA ORF Clone, Mouse, N-His tag MG5A3395-NH
    Factor XIII cDNA ORF Clone, Mouse, C-HA tag MG5A3395-CY
    Factor XIII cDNA ORF Clone, Mouse, N-HA tag MG5A3395-NY
    Factor XIII cDNA ORF Clone, Mouse, C-Myc tag MG5A3395-CM
    Factor XIII cDNA ORF Clone, Mouse, N-Myc tag MG5A3395-NM

    Factor XIII cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Factor XIII cDNA ORF Clone in Cloning Vector, Human HG11510-M
    Factor XIII cDNA ORF Clone, Human, untagged HG11510-UT
    Factor XIII Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11510-ACGLN
    Factor XIII cDNA ORF Clone, Human, C-GFPSpark® tag HG11510-ACG
    Factor XIII cDNA ORF Clone, Human, C-OFPSpark® tag HG11510-ACR
    Factor XIII cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11510-CF
    Factor XIII cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11510-NF
    Factor XIII cDNA ORF Clone, Human, C-His tag HG11510-CH
    Factor XIII cDNA ORF Clone, Human, N-His tag HG11510-NH
    Factor XIII cDNA ORF Clone, Human, C-HA tag HG11510-CY
    Factor XIII cDNA ORF Clone, Human, N-HA tag HG11510-NY
    Factor XIII cDNA ORF Clone, Human, C-Myc tag HG11510-CM
    Factor XIII qPCR Primer Pairs, Human HP101381
    info info
    添加购物车成功! 添加购物车失败!