Factor X cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG11076-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Factor X Reagents
CRO Services
Product recommended

All Factor X Reagents
Factor X cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1461 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 792 C>T not causing the amino acid variation.
Description
Full length Clone DNA of Human coagulation factor X with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
KpnI + XbaI (6kb + 1.51kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Factor X cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Factor X cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Human Coagulation Factor X/F10 Gene Expression validated Image 1698
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
other Green fluorescent protein / GFP Gene Plasmid Map 5609
Factor X cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
coagulation factor 10 cDNA ORF Clone, Human;coagulation factor X cDNA ORF Clone, Human;FX cDNA ORF Clone, Human;FXA cDNA ORF Clone, Human
Factor X Background Information

Coagulation factor X, also known as FX, F10, Eponym Stuart-Prower factor, and thrombokinase, is an enzyme of the coagulation cascade. It is one of the vitamin K-dependent serine proteases, and plays a crucial role in the coagulation cascade and blood clotting, as the first enzyme in the common pathway of thrombus formation. Factor X deficiency is one of the rarest of the inherited coagulation disorders. FX deficiency among the most severe of the rare coagulation defects, typically including hemarthroses, hematomas, and umbilical cord, gastrointestinal, and central nervous system bleeding. Factor X is synthesized in the liver as a mature heterodimer formed from a single-chain precursor, and vitamin K is essential for its synthesis. Factor X is activated into factor Xa (FXa) by both factor IX (with its cofactor, factor VIII in a complex known as intrinsic Xase) and factor VII (with its cofactor, tissue factor in a complex known as extrinsic Xase) through cleaving the activation propeptide. As the first member of the final common pathway or thrombin pathway, FXa converts prothrombin to thrombin in the presence of factor Va, Ca2+, and phospholipid during blood clotting and cleaves prothrombin in two places (an arg-thr and then an arg-ile bond). This process is optimized when factor Xa is complexed with activated cofactor V in the prothrombinase complex. Inborn deficiency of factor X is very uncommon, and may present with epistaxis (nose bleeds), hemarthrosis (bleeding into joints) and gastrointestinal blood loss. Apart from congenital deficiency, low factor X levels may occur occasionally in a number of disease states. Furhermore, factor X deficiency may be seen in amyloidosis, where factor X is adsorbed to the amyloid fibrils in the vasculature.

Full Name
coagulation factor X
References
  • Rosen ED. (2002) Gene targeting in hemostasis. Factor X. Front Biosci. 7: d1915-25.
  • Uprichard J, et al. (2002) Factor X deficiency. Blood Rev. 16(2): 97-110.
  • Borensztajn K, et al. (2008) Factor Xa: at the crossroads between coagulation and signaling in physiology and disease. Trends Mol Med. 14(10): 429-40.
  • Menegatti M, et al. (2009) Factor X deficiency. Semin Thromb Hemost. 35(4): 407-15.
  • Factor X cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Factor X cDNA ORF Clone in Cloning Vector, Rat RG81157-U
    Factor X cDNA ORF Clone, Rat, untagged RG81157-UT
    Factor X Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81157-ACGLN
    Factor X cDNA ORF Clone, Rat, C-GFPSpark® tag RG81157-ACG
    Factor X cDNA ORF Clone, Rat, C-OFPSpark® tag RG81157-ACR
    Factor X cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81157-CF
    Factor X cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81157-NF
    Factor X cDNA ORF Clone, Rat, C-His tag RG81157-CH
    Factor X cDNA ORF Clone, Rat, N-His tag RG81157-NH
    Factor X cDNA ORF Clone, Rat, C-HA tag RG81157-CY
    Factor X cDNA ORF Clone, Rat, N-HA tag RG81157-NY
    Factor X cDNA ORF Clone, Rat, C-Myc tag RG81157-CM
    Factor X cDNA ORF Clone, Rat, N-Myc tag RG81157-NM
    Factor X qPCR Primer Pairs, Rat RP301113

    Factor X cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Factor X cDNA ORF Clone in Cloning Vector, Mouse MG50363-M
    Factor X cDNA ORF Clone, Mouse, untagged MG50363-UT
    Factor X cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50363-ACG
    Factor X Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50363-ACGLN
    Factor X cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50363-ACR
    Factor X cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50363-CF
    Factor X cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50363-NF
    Factor X cDNA ORF Clone, Mouse, C-His tag MG50363-CH
    Factor X cDNA ORF Clone, Mouse, N-His tag MG50363-NH
    Factor X cDNA ORF Clone, Mouse, C-HA tag MG50363-CY
    Factor X cDNA ORF Clone, Mouse, N-HA tag MG50363-NY
    Factor X cDNA ORF Clone, Mouse, C-Myc tag MG50363-CM
    Factor X cDNA ORF Clone, Mouse, N-Myc tag MG50363-NM
    Factor X qPCR Primer Pairs, Mouse MP200384

    Factor X cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Factor X cDNA ORF Clone in Cloning Vector, Human HG11076-G
    Factor X cDNA ORF Clone, Human, untagged HG11076-UT
    Factor X cDNA ORF Clone, Human, C-GFPSpark® tag HG11076-ACG
    Factor X Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11076-ACGLN
    Factor X cDNA ORF Clone, Human, N-GFPSpark® tag HG11076-ANG
    Factor X cDNA ORF Clone, Human, C-OFPSpark® tag HG11076-ACR
    Factor X cDNA ORF Clone, Human, N-OFPSpark® tag HG11076-ANR
    Factor X cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11076-NF
    Factor X cDNA ORF Clone, Human, C-His tag HG11076-CH
    Factor X cDNA ORF Clone, Human, N-His tag HG11076-NH
    Factor X cDNA ORF Clone, Human, C-HA tag HG11076-CY
    Factor X cDNA ORF Clone, Human, N-HA tag HG11076-NY
    Factor X cDNA ORF Clone, Human, C-Myc tag HG11076-CM
    Factor X cDNA ORF Clone, Human, N-Myc tag HG11076-NM
    Factor X qPCR Primer Pairs, Human HP100999
    info info
    添加购物车成功! 添加购物车失败!