ErbB4 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10363-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All ErbB4 Reagents
CRO Services
Product recommended

All ErbB4 Reagents
ErbB4 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
3879 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian), transcript variant JM-a/CVT-2 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
KpnI (two restriction sites) + XbaI (6kb+2.22kb+1.71kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
ErbB4 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ErbB4 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Human ERBB4/HER4 Gene Plasmid Map 5689
Human ERBB4/HER4 Gene Expression validated Image 14276
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
ErbB4 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
ALS19 cDNA ORF Clone, Human;HER4 cDNA ORF Clone, Human;p180erbB4 cDNA ORF Clone, Human
ErbB4 Background Information

ERBB4 is a single-pass type I membrane protein with multiple cysteine rich domains, a transmembrane domain, a tyrosine kinase domain, a phosphotidylinositol-3 kinase binding site and a PDZ domain binding motif. ERBB4 is expressed at highest levels in brain, heart, kidney, in addition to skeletal muscle, parathyroid, cerebellum, pituitary, spleen, testis and breast. And lower levels in thymus, lung, salivary gland, and pancreas. It specifically binds to and is activated by neuregulins, NRG-2, NRG-3, heparin-binding EGF-like growth factor, betacellulin and NTAK. ERBB4 also can be activated by other factors and induces a variety of cellular responses including mitogenesis and differentiation. ERBB4 regulates development of the heart, the central nervous system and the mammary gland, gene transcription, cell proliferation, differentiation, migration and apoptosis. It is required for normal cardiac muscle differentiation during embryonic development, and for postnatal cardiomyocyte proliferation. ERBB4 also play a role on the normal development of the embryonic central nervous system, especially for normal neural crest cell migration and normal axon guidance. It is required for mammary gland differentiation, induction of milk proteins and lactation.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
erb-b2 receptor tyrosine kinase 4
References
  • Huang, Y Z, et al. (2000) Regulation of neuregulin signaling by PSD-95 interacting with ErbB4 at CNS synapses. Neuron. 26(2):443-55.
  • Garcia, R A, et al. (2000) The neuregulin receptor ErbB-4 interacts with PDZ-containing proteins at neuronal synapses. Proc Natl Acad Sci. 97(7):3596-601.
  • Silberberg G, et al. (2006) The involvement of ErbB4 with schizophrenia: association and expression studies. Am J Med Genet. 141(B2):142-8.
  • Sardi SP, et al. (2006) Presenilin-dependent ErbB4 nuclear signaling regulates the timing of astrogenesis in the developing brain. Cell. 127(1):185-97.
  • ErbB4 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    ErbB4 cDNA ORF Clone in Cloning Vector, Rat RG80125-G
    ErbB4 cDNA ORF Clone, Rat, untagged RG80125-UT
    ErbB4 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80125-ACGLN
    ErbB4 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80125-ACG
    ErbB4 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80125-ACR
    ErbB4 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80125-CF
    ErbB4 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80125-NF
    ErbB4 cDNA ORF Clone, Rat, C-His tag RG80125-CH
    ErbB4 cDNA ORF Clone, Rat, N-His tag RG80125-NH
    ErbB4 cDNA ORF Clone, Rat, C-HA tag RG80125-CY
    ErbB4 cDNA ORF Clone, Rat, N-HA tag RG80125-NY
    ErbB4 cDNA ORF Clone, Rat, C-Myc tag RG80125-CM
    ErbB4 cDNA ORF Clone, Rat, N-Myc tag RG80125-NM
    ErbB4 qPCR Primer Pairs, Rat RP300120

    ErbB4 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    ErbB4 cDNA ORF Clone in Cloning Vector, Human HG10363-M
    ErbB4 cDNA ORF Clone, Human, untagged HG10363-UT
    ErbB4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10363-ACGLN
    ErbB4 cDNA ORF Clone, Human, C-GFPSpark® tag HG10363-ACG
    ErbB4 cDNA ORF Clone, Human, C-OFPSpark® tag HG10363-ACR
    ErbB4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10363-NF
    ErbB4 cDNA ORF Clone, Human, C-His tag HG10363-CH
    ErbB4 cDNA ORF Clone, Human, N-His tag HG10363-NH
    ErbB4 cDNA ORF Clone, Human, C-HA tag HG10363-CY
    ErbB4 cDNA ORF Clone, Human, N-HA tag HG10363-NY
    ErbB4 cDNA ORF Clone, Human, C-Myc tag HG10363-CM
    ErbB4 cDNA ORF Clone, Human, N-Myc tag HG10363-NM
    ErbB4 qPCR Primer Pairs, Human HP100398
    info info
    添加购物车成功! 添加购物车失败!