Quick Order

Human ErbB3 / HER3 transcript variant 1 ORF mammalian expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human ERBB3 cDNA Clone Product Information
NCBI RefSeq:NM_001982.2
RefSeq ORF Size:4029bp
cDNA Description:Full length Clone DNA of Homo sapiens v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian) , transcript variant 1 with N terminal His tag.
Gene Synonym:HER3, LCCS2, ErbB-3, c-erbB3, erbB3-S, MDA-BF-1, MGC88033, c-erbB-3, p180-ErbB3, p45-sErbB3, p85-sErbB3, ERBB3
Species:Human
Vector:pCMV3-N-His
Plasmid:pCMV3-His-ERBB3
Restriction Site:KpnI + NotI (6kb + 4.08kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human ERBB3 Gene Plasmid Map
Human ErbB3 / HER3 transcript variant 1 natural ORF mammalian expression plasmid, N-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

ErbB3, also known as Her3(human epidermal growth factor receptor3), is a member of the epidermal growth factor receptor (EGFR) family of receptor tyrosine kinases. This membrane-bound glycoprotein has a neuregulin binding domain but has not an active kinase domain., and therefore can not mediate the intracellular signal transduction through protein phosphorylation. However, its heterodimer with ErbB2 or other EGFR members responsible for tyrosine phosphorylation forms a receptor complex with high affinity, and initiates the related pathway which lead to cell proliferation or differentiation. ErbB3 has been shown to implicated in numerous cancers, including prostate, bladder, and breast tumors. This protein has different isoforms derived from alternative splicing variants, and among which, the secreted isoform lacking the intermembrane region modulates the activity of membrane-bound form.

Size / Price
Catalog: HG10201-NH
List Price:   (Save )
Price:      [How to order]
Availability
 Shipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"