Quick Order

Human HER2/ERBB2 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag

DatasheetReviewsRelated ProductsProtocols
Human ERBB2 cDNA Clone Product Information
NCBI RefSeq:NM_004448.2
RefSeq ORF Size:3768bp
cDNA Description:Full length Clone DNA of Homo sapiens v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian), transcript variant 1 with C terminal GFPSpark tag.
Gene Synonym:ErbB2, NEU, NGL, HER2, TKR1, CD340, HER-2, c-erbB2, HER-2/neu, p185erbB2
Species:Human
Vector:pCMV3-C-GFPSpark
Plasmid:pCMV3-ERBB2-GFPSpark
Restriction Site:HindIII + XbaI (6kb + 4.5kb)
Tag Sequence:GFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human ERBB2 Gene Plasmid Map
Human ErbB2 / HER2 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-tagged
Human ERBB2 Gene Expression validated Image
Human ErbB2 / HER2 transcript variant 1 natural ORF mammalian expression plasmid, C-GFPSpark tag
[Click to enlarge image]
Caption:
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat#STF01) transiently. After 48 h, the fluorescent signals can be detected by fluorescence microscope. Green excitation 475/40nm, emission 535/45nm. Red excitation 560/55nm, emission 645/45nm. Orange excitation 525/45nm, emission 595/60nm.
GFPSpark Tag Info

GFPSpark is an improved variant of the green fluorescent protein GFP. It possesses bright green fluorescence (excitation/ emission max = 487 / 508 nm) that is visible earlier than fluorescence of other green fluorescent proteins. GFPSpark is mainly intended for applications where fast appearance of bright fluorescence is crucial. It is specially recommended for cell and organelle labeling and tracking the promoter activity.

Product nameProduct name
Background

Human epidermal growth factor receptor 2 (HER2), also known as ErbB2, NEU, and CD340, is a type I membrane glycoprotein, and belongs to the epidermal growth factor (EGF) receptor family. HER2 protein cannot bind growth factors due to the lacking of ligand binding domain of its own and autoinhibited constitutively. However, HER2 forms a heterodimer with other ligand-bound EGF receptor family members, therefore stabilizes ligand binding and enhances kinase-mediated activation of downstream molecules. HER2 plays a key role in development, cell proliferation and differentiation. HER2 gene has been reported to associate with malignancy and a poor prognosis in numerous carcinomas, including breast, prostate, ovarian, lung cancers and so on.

References
  • Krawczyk N, et al. (2009) HER2 status on persistent disseminated tumor cells after adjuvant therapy may differ from initial HER2 status on primary tumor. Anticancer Res. 29(10): 4019-24.
  • Size / Price
    Catalog: HG10004-ACG
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
    • Human ErbB2 / HER2 transcript variant 1 natural ORF mammalian expression plasmid, C-GFPSpark tag
    • Human ErbB2 / HER2 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-tagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"