Ephrin A5 cDNA ORF Clone, Human, N-His tag

Cat: HG10192-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Ephrin A5 Reagents
CRO Services
Product recommended

All Ephrin A5 Reagents
Ephrin A5 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
687 bp
Description
Full length Clone DNA of Human ephrin-A5 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Ephrin A5 cDNA ORF Clone, Human, N-His tag Alternative Names
AF1 cDNA ORF Clone, Human;EFL5 cDNA ORF Clone, Human;EPLG7 cDNA ORF Clone, Human;GLC1M cDNA ORF Clone, Human;LERK7 cDNA ORF Clone, Human;RAGS cDNA ORF Clone, Human
Ephrin A5 Background Information

Ephrin-A5 also known as EFNA5, is a member of the Ephrin family. The Eph family receptor interacting proteins (ephrins) are a family of proteins that serve as the ligands of the Eph receptor, which compose the largest known subfamily of receptor protein-tyrosine kinases (RTKs). Ephrin subclasses are further distinguished by their mode of attachment to the plasma membrane: ephrin-A ligands bind EphA receptors and are anchored to the plasma membrane via a glycosylphosphatidylinositol (GPI) linkage, whereas ephrin-B ligands bind EphB receptors and are anchored via a transmembrane domain. Ephrin-A5/EFNA5 may function actively to stimulate axon fasciculation. The interaction of EFNA5 with EPHA5 also mediates communication between pancreatic islet cells to regulate glucose-stimulated insulin secretion. Ephrin-A5/EFNA5 also serves as a cognate/functional ligand for EPHA7, their interaction regulates brain development modulating cell-cell adhesion and repulsion.

Full Name
ephrin-A5
References
  • Frisén J, et al. (1998) Ephrin-A5 (AL-1/RAGS) is essential for proper retinal axon guidance and topographic mapping in the mammalian visual system. Neuron. 20(2): 235-43.
  • Feldheim DA, et al. (2000) Genetic analysis of ephrin-A2 and ephrin-A5 shows their requirement in multiple aspects of retinocollicular mapping. Neuron. 25(3): 563-74.
  • Wahl S, et al. (2000) Ephrin-A5 induces collapse of growth cones by activating Rho and Rho kinase. J Cell Biol. 149(2): 263-70.
  • Ephrin A5 cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    Ephrin A5 cDNA ORF Clone in Cloning Vector, Canine DG70072-G
    Ephrin A5 cDNA ORF Clone, Canine, untagged DG70072-UT
    Ephrin A5 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70072-ACG
    Ephrin A5 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70072-ACGLN
    Ephrin A5 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70072-ACR
    Ephrin A5 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70072-CF
    Ephrin A5 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70072-NF
    Ephrin A5 cDNA ORF Clone, Canine, C-His tag DG70072-CH
    Ephrin A5 cDNA ORF Clone, Canine, N-His tag DG70072-NH
    Ephrin A5 cDNA ORF Clone, Canine, C-HA tag DG70072-CY
    Ephrin A5 cDNA ORF Clone, Canine, N-HA tag DG70072-NY
    Ephrin A5 cDNA ORF Clone, Canine, C-Myc tag DG70072-CM
    Ephrin A5 cDNA ORF Clone, Canine, N-Myc tag DG70072-NM

    Ephrin A5 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    Ephrin A5 cDNA ORF Clone in Cloning Vector, Rhesus CG90044-G

    Ephrin A5 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Ephrin A5 cDNA ORF Clone in Cloning Vector, Rat RG80105-G
    Ephrin A5 cDNA ORF Clone, Rat, untagged RG80105-UT
    Ephrin A5 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80105-ACG
    Ephrin A5 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80105-ACGLN
    Ephrin A5 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80105-ACR
    Ephrin A5 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80105-CF
    Ephrin A5 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80105-NF
    Ephrin A5 cDNA ORF Clone, Rat, C-His tag RG80105-CH
    Ephrin A5 cDNA ORF Clone, Rat, N-His tag RG80105-NH
    Ephrin A5 cDNA ORF Clone, Rat, C-HA tag RG80105-CY
    Ephrin A5 cDNA ORF Clone, Rat, N-HA tag RG80105-NY
    Ephrin A5 cDNA ORF Clone, Rat, C-Myc tag RG80105-CM
    Ephrin A5 cDNA ORF Clone, Rat, N-Myc tag RG80105-NM
    Ephrin A5 qPCR Primer Pairs, Rat RP300100

    Ephrin A5 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Ephrin A5 cDNA ORF Clone in Cloning Vector, Mouse MG50597-M
    Ephrin A5 cDNA ORF Clone, Mouse, untagged MG50597-UT
    Ephrin A5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50597-ACGLN
    Ephrin A5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50597-ACG
    Ephrin A5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50597-ACR
    Ephrin A5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50597-CF
    Ephrin A5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50597-NF
    Ephrin A5 cDNA ORF Clone, Mouse, C-His tag MG50597-CH
    Ephrin A5 cDNA ORF Clone, Mouse, N-His tag MG50597-NH
    Ephrin A5 cDNA ORF Clone, Mouse, C-HA tag MG50597-CY
    Ephrin A5 cDNA ORF Clone, Mouse, N-HA tag MG50597-NY
    Ephrin A5 cDNA ORF Clone, Mouse, C-Myc tag MG50597-CM
    Ephrin A5 cDNA ORF Clone, Mouse, N-Myc tag MG50597-NM
    Ephrin A5 qPCR Primer Pairs, Mouse MP200582

    Ephrin A5 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Ephrin A5 cDNA ORF Clone in Cloning Vector, Human HG10192-M
    Ephrin A5 cDNA ORF Clone, Human, untagged HG10192-UT
    Ephrin A5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10192-ACGLN
    Ephrin A5 cDNA ORF Clone, Human, C-GFPSpark® tag HG10192-ACG
    Ephrin A5 cDNA ORF Clone, Human, C-OFPSpark® tag HG10192-ACR
    Ephrin A5 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10192-CF
    Ephrin A5 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10192-NF
    Ephrin A5 cDNA ORF Clone, Human, C-His tag HG10192-CH
    Ephrin A5 cDNA ORF Clone, Human, C-HA tag HG10192-CY
    Ephrin A5 cDNA ORF Clone, Human, N-HA tag HG10192-NY
    Ephrin A5 cDNA ORF Clone, Human, C-Myc tag HG10192-CM
    Ephrin A5 cDNA ORF Clone, Human, N-Myc tag HG10192-NM
    Ephrin A5 qPCR Primer Pairs, Human HP100258
    info info
    添加购物车成功! 添加购物车失败!