Ephrin A3 cDNA ORF Clone, Human, N-His tag

Cat: HG10188-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Ephrin A3 Reagents
CRO Services
Product recommended

All Ephrin A3 Reagents
Ephrin A3 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
717 bp
Description
Full length Clone DNA of Human sapiens ephrin-A3 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Ephrin A3 cDNA ORF Clone, Human, N-His tag Alternative Names
EFL2 cDNA ORF Clone, Human;Ehk1-L cDNA ORF Clone, Human;EPLG3 cDNA ORF Clone, Human;LERK3 cDNA ORF Clone, Human
Ephrin A3 Background Information

Ephrin-A3 also known as EPH-related receptor tyrosine kinase ligand 3 or EFNA3, is a member of the ephrin family. The Eph family receptor interacting proteins (ephrins) are a family of proteins that serve as the ligands of the Eph receptor, which compose the largest known subfamily of receptor protein-tyrosine kinases (RTKs). Ephrin-A3 and their Eph family of receptor tyrosine kinases are expressed by cells of the SVZ. Ephrin subclasses are further distinguished by their mode of attachment to the plasma membrane: Ephrin-A3 ligands bind EphA receptors and are anchored to the plasma membrane via a glycosylphosphatidylinositol (GPI) linkage, whereas ephrin-B ligands bind EphB receptors and are anchored via a transmembrane domain. Ephrin-A3 expressed on astrocytes activates EphA4 on the post-synaptic neuron and restricts the growth of dendritic spines through multiple pathways.

Full Name
ephrin-A3
References
  • Klein R. (2009) Bidirectional modulation of synaptic functions by Eph/ephrin signaling. Nat Neurosci. 12(1): 15-20.
  • Lai KO, et al. (2009) Synapse development and plasticity: roles of ephrin/Eph receptor signaling. Curr Opin Neurobiol. 19(3): 275-83.
  • Prevost N, et al. (2002) Interactions between Eph kinases and ephrins provide a mechanism to support platelet aggregation once cell-to-cell contact has occurred. Proc Natl Acad Sci U S A. 99(14): 9219-24.
  • info info
    添加购物车成功! 添加购物车失败!