After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human Ephrin-A3/EFNA3 Gene ORF cDNA clone expression plasmid, N-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human EFNA3 cDNA Clone Product Information
NCBI RefSeq:NM_004952.4
RefSeq ORF Size:717bp
cDNA Description:Full length Clone DNA of Homo sapiens sapiens ephrin-A3 with N terminal Myc tag.
Gene Synonym:EFNA3, EFL2, EPLG3, LERK3, Ehk1-L
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Ephrin-A3 also known as EPH-related receptor tyrosine kinase ligand 3 or EFNA3, is a member of the ephrin family. The Eph family receptor interacting proteins (ephrins) are a family of proteins that serve as the ligands of the Eph receptor, which compose the largest known subfamily of receptor protein-tyrosine kinases (RTKs). Ephrin-A3 and their Eph family of receptor tyrosine kinases are expressed by cells of the SVZ. Ephrin subclasses are further distinguished by their mode of attachment to the plasma membrane: Ephrin-A3 ligands bind EphA receptors and are anchored to the plasma membrane via a glycosylphosphatidylinositol (GPI) linkage, whereas ephrin-B ligands bind EphB receptors and are anchored via a transmembrane domain. Ephrin-A3 expressed on astrocytes activates EphA4 on the post-synaptic neuron and restricts the growth of dendritic spines through multiple pathways.

References
  • Klein R. (2009) Bidirectional modulation of synaptic functions by Eph/ephrin signaling. Nat Neurosci. 12(1): 15-20.
  • Lai KO, et al. (2009) Synapse development and plasticity: roles of ephrin/Eph receptor signaling. Curr Opin Neurobiol. 19(3): 275-83.
  • Prevost N, et al. (2002) Interactions between Eph kinases and ephrins provide a mechanism to support platelet aggregation once cell-to-cell contact has occurred. Proc Natl Acad Sci U S A. 99(14): 9219-24.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"