Quick Order

Text Size:AAA

Human EphrinA3 ORF mammalian expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human EFNA3 cDNA Clone Product Information
NCBI RefSeq:NM_004952.4
RefSeq ORF Size:717bp
cDNA Description:Full length Clone DNA of Homo sapiens sapiens ephrin-A3 with N terminal His tag.
Gene Synonym:EFNA3, EFL2, EPLG3, LERK3, Ehk1-L
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Ephrin-A3 also known as EPH-related receptor tyrosine kinase ligand 3 or EFNA3, is a member of the ephrin family. The Eph family receptor interacting proteins (ephrins) are a family of proteins that serve as the ligands of the Eph receptor, which compose the largest known subfamily of receptor protein-tyrosine kinases (RTKs). Ephrin-A3 and their Eph family of receptor tyrosine kinases are expressed by cells of the SVZ. Ephrin subclasses are further distinguished by their mode of attachment to the plasma membrane: Ephrin-A3 ligands bind EphA receptors and are anchored to the plasma membrane via a glycosylphosphatidylinositol (GPI) linkage, whereas ephrin-B ligands bind EphB receptors and are anchored via a transmembrane domain. Ephrin-A3 expressed on astrocytes activates EphA4 on the post-synaptic neuron and restricts the growth of dendritic spines through multiple pathways.

References
  • Klein R. (2009) Bidirectional modulation of synaptic functions by Eph/ephrin signaling. Nat Neurosci. 12(1): 15-20.
  • Lai KO, et al. (2009) Synapse development and plasticity: roles of ephrin/Eph receptor signaling. Curr Opin Neurobiol. 19(3): 275-83.
  • Prevost N, et al. (2002) Interactions between Eph kinases and ephrins provide a mechanism to support platelet aggregation once cell-to-cell contact has occurred. Proc Natl Acad Sci U S A. 99(14): 9219-24.
  • Size / Price
    Catalog: HG10188-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability
     Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"