Quick Order

Human Ephrin-A1/EFNA1 Gene ORF cDNA clone expression plasmid, N-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human EFNA1 cDNA Clone Product Information
NCBI RefSeq:NM_004428.2
RefSeq ORF Size:618bp
cDNA Description:Full length Clone DNA of Homo sapiens ephrin-A1 with N terminal Myc tag.
Gene Synonym:B61, EFL1, ECKLG, EPLG1, LERK1, TNFAIP4
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

EPH-related receptor tyrosine kinase ligand 1 (abbreviated as Ephrin-A1) also known as ligand of eph-related kinase 1 or EFNA1, is a member of the ephrin (EPH) family. The Eph family receptor interacting proteins (ephrins) are a family of proteins that serve as the ligands of the Eph receptor, which compose the largest known subfamily of receptor protein-tyrosine kinases (RTKs). Ephrin-A1/EFNA1 and its Eph family of receptor tyrosine kinases are expressed by cells of the SVZ. Ephrin subclasses are further distinguished by their mode of attachment to the plasma membrane: ephrin-A ligands bind EphA receptors and are anchored to the plasma membrane via a glycosylphosphatidylinositol (GPI) linkage, whereas ephrin-B ligands bind EphB receptors and are anchored via a transmembrane domain. An exception is the EphA4 receptor, which binds both subclasses of ephrins. Ephrin-A1 and one of its receptor EphA2 were expressed in xenograft endothelial cells and also tumor cells and play a role in human cancers, at least in part by influencing tumor neovascularization.

References
  • Deroanne C, et al. (2003) EphrinA1 inactivates integrin-mediated vascular smooth muscle cell spreading via the Rac/PAK pathway. J Cell Sci. 116(7): 1367-76.
  • Ojima T, et al. (2006) EphrinA1 inhibits vascular endothelial growth factor-induced intracellular signaling and suppresses retinal neovascularization and blood-retinal barrier breakdown. Am J Pathol. 168(1): 331-9.
  • Wu D, et al. (2004) Prognostic value of EphA2 and EphrinA-1 in squamous cell cervical carcinoma. Gynecol Oncol. 94(2): 312-9.
  • Size / Price
    Catalog: HG10882-NM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"