Quick Order

Human EphB6 ORF mammalian expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human EPHB6 cDNA Clone Product Information
NCBI RefSeq:NM_004445.3
RefSeq ORF Size:3021bp
cDNA Description:Full length Clone DNA of Homo sapiens EPH receptor B6 with N terminal His tag.
Gene Synonym:EPHB6, HEP, MGC129910, MGC129911
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Ephrins are divided into the ephrin-A (EFNA) class and the ephrin-B (EFNB) class based on their structures and sequence relationships. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. EphB6 is an unusual Eph receptor, lacking catalytic capacity due to alterations in its kinase domain. Interestingly, increased metastatic activity is associated with reduced EphB6 receptor expression in several tumor types, including breast cancer. This emphasizes the potential of EphB6 to act as a suppressor of cancer aggressiveness. EphB6 suppress cancer invasiveness through c-Cbl-dependent signaling, morphologic changes, and cell attachment and indicate that EphB6 may represent a useful prognostic marker and a promising target for therapeutic approaches. EphB6 can both positively and negatively regulate cell adhesion and migration, and suggest that tyrosine phosphorylation of the receptor by an Src family kinase acts as the molecular switch for the functional transition. In addition, Ephrin-B2 may be a physiological ligand for the EphB6 receptor.

References
  • Munthe E, et al. (2000)Ephrin-B2 is a candidate ligand for the Eph receptor, EphB6. FEBS Lett. 466(1): 169-74.
  • Matsuoka H, et al. (2005) Biphasic functions of the kinase-defective Ephb6 receptor in cell adhesion and migration. J Biol Chem. 280(32): 29355-63.
  • Truitt L, et al. (2010) The EphB6 receptor cooperates with c-Cbl to regulate the behavior of breast cancer cells. Cancer Res. 70(3): 1141-53.
  • Size / Price
    Catalog: HG10197-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability
     Shipping instructions
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"