Quick Order

Text Size:AAA

Human Ezrin / villin 2 Gene ORF cDNA clone expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human EZR cDNA Clone Product Information
NCBI RefSeq:NM_001111077.1
RefSeq ORF Size:1761bp
cDNA Description:Full length Clone DNA of Homo sapiens ezrin with C terminal Myc tag.
Gene Synonym:CVL; CVIL; VIL2; HEL-S-105
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

VIL2, also known as villin-2, belongs to the ERM protein family. It is expressed in cerebral cortex, basal ganglia, hippocampus, hypophysis, and optic nerve. VIL2 contains 1 FERM domain and may be involved in connections of major cytoskeletal structures to the plasma membrane. It plays a key role in cell surface structure adhesion, migration, and organization. In epithelial cells, VIL2 is required for the formation of microvilli and membrane ruffles on the apical pole. It interacts with MPP5 and SLC9A3R2. It is found VIL2 form a complex with PODXL and SLC9A3R2. It also interacts with MCC, PLEKHG6, PODXL, SCYL3/PACE1, SLC9A3R1 and TMEM8B.

References
  • Grnholm M, et al. (1999) Homotypic and heterotypic interaction of the neurofibromatosis 2 tumor suppressor protein merlin and the ERM protein ezrin. J Cell Sci. 112(6):895-904.
  • Sitaraman, et al. (2002) The adenosine 2b receptor is recruited to the plasma membrane and associates with E3KARP and Ezrin upon agonist stimulation. J Biol Chem. 277(36):33188-95.
  • Gould KL, et al. (1989) cDNA cloning and sequencing of the protein-tyrosine kinase substrate, ezrin, reveals homology to band 4.1. EMBO J. 8(13):4133-42.
  • Size / Price
    Catalog: HG12858-CM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"