ETHE1 cDNA ORF Clone, Human, N-HA tag

Cat: HG14681-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ETHE1 Reagents
CRO Services
Product recommended

All ETHE1 Reagents
ETHE1 cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
765 bp
Description
Full length Clone DNA of Human ethylmalonic encephalopathy 1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ETHE1 cDNA ORF Clone, Human, N-HA tag Alternative Names
HSCO cDNA ORF Clone, Human;YF13H12 cDNA ORF Clone, Human
ETHE1 Background Information

ETHE1, also known as HSCO, is a sulfur dioxygenase that localizes within the mitochondrial matrix. ETHE1 probably plays an important role in metabolic homeostasis in mitochondria. It may also function as a nuclear-cytoplasmic shuttling protein that binds transcription factor RELA/NFKB3 in the nucleus and exports it to the cytoplasm. ETHE1 can suppresses p53-induced apoptosis by preventing nuclear localization of RELA. Mutations in ETHE1 gene result in ethylmalonic encephalopathy. Ethylmalonic encephalopathy is an autosomal recessive, invariably fatal disorder characterized by early-onset encephalopathy, microangiopathy, chronic diarrhea, defective cytochrome c oxidase (COX) in muscle and brain, high concentrations of C4 and C5 acylcarnitines in blood and high excretion of ethylmalonic acid in urine.

Full Name
ethylmalonic encephalopathy 1
References
  • Higashitsuji. et al., 2002, Cancer Cell. 2 (4): 335-46.
  • McCoy JG. et al., 2007, Acta Crystallogr D Biol Crystallogr. 62 (9): 964-70.
  • Mehrle A. et al., 2006, Nucleic Acids Res. 34: D415-8.
  • ETHE1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    ETHE1 cDNA ORF Clone in Cloning Vector, Mouse MG5A5216-U
    ETHE1 cDNA ORF Clone, Mouse, untagged MG5A5216-UT
    ETHE1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A5216-ACGLN
    ETHE1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A5216-ACG
    ETHE1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A5216-ANG
    ETHE1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A5216-ACR
    ETHE1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A5216-ANR
    ETHE1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A5216-CF
    ETHE1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A5216-NF
    ETHE1 cDNA ORF Clone, Mouse, C-His tag MG5A5216-CH
    ETHE1 cDNA ORF Clone, Mouse, N-His tag MG5A5216-NH
    ETHE1 cDNA ORF Clone, Mouse, C-HA tag MG5A5216-CY
    ETHE1 cDNA ORF Clone, Mouse, N-HA tag MG5A5216-NY
    ETHE1 cDNA ORF Clone, Mouse, C-Myc tag MG5A5216-CM
    ETHE1 cDNA ORF Clone, Mouse, N-Myc tag MG5A5216-NM

    ETHE1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    ETHE1 cDNA ORF Clone in Cloning Vector, Human HG14681-G
    ETHE1 cDNA ORF Clone, Human, untagged HG14681-UT
    ETHE1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14681-ACGLN
    ETHE1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14681-ACG
    ETHE1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14681-ANG
    ETHE1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14681-ACR
    ETHE1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14681-ANR
    ETHE1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14681-CF
    ETHE1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14681-NF
    ETHE1 cDNA ORF Clone, Human, C-His tag HG14681-CH
    ETHE1 cDNA ORF Clone, Human, N-His tag HG14681-NH
    ETHE1 cDNA ORF Clone, Human, C-HA tag HG14681-CY
    ETHE1 cDNA ORF Clone, Human, C-Myc tag HG14681-CM
    ETHE1 cDNA ORF Clone, Human, N-Myc tag HG14681-NM
    ETHE1 qPCR Primer Pairs, Human HP103315
    info info
    添加购物车成功! 添加购物车失败!