After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human ETHE1 / HSCO Gene ORF cDNA clone expression plasmid, N-Flag tag

DatasheetReviewsRelated ProductsProtocols
Human ETHE1 cDNA Clone Product Information
NCBI RefSeq:BC008250
RefSeq ORF Size:765bp
cDNA Description:Full length Clone DNA of Homo sapiens ethylmalonic encephalopathy 1 with N terminal Flag tag.
Gene Synonym:HSCO, YF13H12
Species:Human
Vector:pCMV3-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

ETHE1, also known as HSCO, is a sulfur dioxygenase that localizes within the mitochondrial matrix. ETHE1 probably plays an important role in metabolic homeostasis in mitochondria. It may also function as a nuclear-cytoplasmic shuttling protein that binds transcription factor RELA/NFKB3 in the nucleus and exports it to the cytoplasm. ETHE1 can suppresses p53-induced apoptosis by preventing nuclear localization of RELA. Mutations in ETHE1 gene result in ethylmalonic encephalopathy. Ethylmalonic encephalopathy is an autosomal recessive, invariably fatal disorder characterized by early-onset encephalopathy, microangiopathy, chronic diarrhea, defective cytochrome c oxidase (COX) in muscle and brain, high concentrations of C4 and C5 acylcarnitines in blood and high excretion of ethylmalonic acid in urine.

References
  • Higashitsuji. et al., 2002, Cancer Cell. 2 (4): 335-46.
  • McCoy JG. et al., 2007, Acta Crystallogr D Biol Crystallogr. 62 (9): 964-70.
  • Mehrle A. et al., 2006, Nucleic Acids Res. 34: D415-8.
  • Size / Price
    Catalog: HG14681-NF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"