ERP27 cDNA ORF Clone, Human, N-Myc tag

Cat: HG13256-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ERP27 Reagents
CRO Services
Product recommended

All ERP27 Reagents
ERP27 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
822 bp
Description
Full length Clone DNA of Human endoplasmic reticulum protein 27 kDa with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ERP27 cDNA ORF Clone, Human, N-Myc tag Alternative Names
C12orf46 cDNA ORF Clone, Human;PDIA8 cDNA ORF Clone, Human
ERP27 Background Information

ERP27 contains 1 thioredoxin domain and is a noncatalytic member of the protein disulfide isomerase family. Protein disulfide isomerases (PDIs) constitute a family of structurally related enzymes which catalyze disulfide bonds formation, reduction, or isomerization of newly synthesized proteins in the lumen of the endoplasmic reticulum (ER). They act also as chaperones, and are, therefore, part of a quality-control system for the correct folding of the proteins in the same subcellular compartment. PDI has been found to have moderate effects (25-fold) on the rate of oxidative folding of proteins in vitro. Recombinant Human Protein Disulfide Isomerase is involved in disulphide-bond formation and isomerization, as well as the reduction of disulphide bonds in proteins. Recombinant PDI has been found to have moderate effects (25-fold) on the rate of oxidative folding of proteins in vitro. ERP27 is a widely expressed protein which localizes to the ER and may act as a protease, protein disulfide isomerase, thiol-disulfide oxidase or phospholipase. ERP27 doesn't contain a CXXC active site motif indicating that it is a catalytically redox-inactive member of the protein disulfide isomerase family.

Full Name
endoplasmic reticulum protein 27
References
  • Lamesch P, et al. (2007) hORFeome v3.1: a resource of human open reading frames representing over 10,000 human genes. Genomics. 89(3):307-15.
  • Ota T, et al. (2004) Complete sequencing and characterization of 21,243 full-length human cDNAs. Nat Genet. 36(1):40-5.
  • Alanen HI, et al. (2006) ERp27, a new non-catalytic endoplasmic reticulum-located human protein disulfide isomerase family member, interacts with ERp57. J Biol Chem. 281(44):33727-38.
  • info info
    添加购物车成功! 添加购物车失败!