C2orf30 cDNA ORF Clone, Human, N-HA tag

Cat: HG13568-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All C2orf30 Reagents
CRO Services
Product recommended

All C2orf30 Reagents
C2orf30 cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1443 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human chromosome 2 open reading frame 30 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-HA
Restriction Sites
HindIII + XbaI(6kb+1.44kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
C2orf30 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information
More Information About C2orf30
Entrez Gene ID

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

C2orf30 cDNA ORF Clone, Human, N-HA tag Validated Images
Human HER2/ERBB2 Gene Plasmid Map 5633
C2orf30 cDNA ORF Clone, Human, N-HA tag Alternative Names
C2orf30 cDNA ORF Clone, Human;CIM cDNA ORF Clone, Human;CL24936 cDNA ORF Clone, Human;CL25084 cDNA ORF Clone, Human;HEL117 cDNA ORF Clone, Human;XTP3-B cDNA ORF Clone, Human;XTP3TPB cDNA ORF Clone, Human
C2orf30 Background Information
Full Name
endoplasmic reticulum lectin 1

C2orf30 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
C2orf30 cDNA ORF Clone in Cloning Vector, Rat RG8A4620-U
C2orf30 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A4620-ACGLN

C2orf30 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
C2orf30 cDNA ORF Clone in Cloning Vector, Mouse MG52559-G
C2orf30 cDNA ORF Clone, Mouse, untagged MG52559-UT
C2orf30 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52559-ACGLN
C2orf30 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52559-ACG
C2orf30 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52559-ACR
C2orf30 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52559-CF
C2orf30 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52559-NF
C2orf30 cDNA ORF Clone, Mouse, C-His tag MG52559-CH
C2orf30 cDNA ORF Clone, Mouse, N-His tag MG52559-NH
C2orf30 cDNA ORF Clone, Mouse, C-HA tag MG52559-CY
C2orf30 cDNA ORF Clone, Mouse, N-HA tag MG52559-NY
C2orf30 cDNA ORF Clone, Mouse, C-Myc tag MG52559-CM
C2orf30 cDNA ORF Clone, Mouse, N-Myc tag MG52559-NM
C2orf30 qPCR Primer Pairs, Mouse MP202432

C2orf30 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
C2orf30 cDNA ORF Clone in Cloning Vector, Human HG13568-G
C2orf30 cDNA ORF Clone, Human, untagged HG13568-UT
C2orf30 cDNA ORF Clone, Human, C-GFPSpark® tag HG13568-ACG
C2orf30 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13568-ACGLN
C2orf30 cDNA ORF Clone, Human, C-OFPSpark® tag HG13568-ACR
C2orf30 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13568-CF
C2orf30 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13568-NF
C2orf30 cDNA ORF Clone, Human, C-His tag HG13568-CH
C2orf30 cDNA ORF Clone, Human, N-His tag HG13568-NH
C2orf30 cDNA ORF Clone, Human, C-HA tag HG13568-CY
C2orf30 cDNA ORF Clone, Human, C-Myc tag HG13568-CM
C2orf30 cDNA ORF Clone, Human, N-Myc tag HG13568-NM
C2orf30 qPCR Primer Pairs, Human HP102254
info info
添加购物车成功! 添加购物车失败!