MAPK6 cDNA ORF Clone, Human, C-Myc tag

Cat: HG10662-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All MAPK6 Reagents
CRO Services
Product recommended

All MAPK6 Reagents
MAPK6 cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2166 bp
Description
Full length Clone DNA of Human mitogen-activated protein kinase 6 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MAPK6 cDNA ORF Clone, Human, C-Myc tag Alternative Names
ERK3 cDNA ORF Clone, Human;HsT17250 cDNA ORF Clone, Human;p97MAPK cDNA ORF Clone, Human;PRKM6 cDNA ORF Clone, Human
MAPK6 Background Information
Full Name
mitogen-activated protein kinase 6

MAPK6 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MAPK6 cDNA ORF Clone in Cloning Vector, Mouse MG50847-G
MAPK6 cDNA ORF Clone, Mouse, untagged MG50847-UT
MAPK6 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50847-ACGLN
MAPK6 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50847-ACG
MAPK6 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50847-ANG
MAPK6 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50847-ACR
MAPK6 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50847-ANR
MAPK6 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50847-CF
MAPK6 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50847-NF
MAPK6 cDNA ORF Clone, Mouse, C-His tag MG50847-CH
MAPK6 cDNA ORF Clone, Mouse, N-His tag MG50847-NH
MAPK6 cDNA ORF Clone, Mouse, C-HA tag MG50847-CY
MAPK6 cDNA ORF Clone, Mouse, N-HA tag MG50847-NY
MAPK6 cDNA ORF Clone, Mouse, C-Myc tag MG50847-CM
MAPK6 cDNA ORF Clone, Mouse, N-Myc tag MG50847-NM
MAPK6 qPCR Primer Pairs, Mouse MP200818

MAPK6 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MAPK6 cDNA ORF Clone in Cloning Vector, Human HG10662-M
MAPK6 cDNA ORF Clone, Human, untagged HG10662-UT
MAPK6 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10662-ACGLN
MAPK6 cDNA ORF Clone, Human, C-GFPSpark® tag HG10662-ACG
MAPK6 cDNA ORF Clone, Human, N-GFPSpark® tag HG10662-ANG
MAPK6 cDNA ORF Clone, Human, C-OFPSpark® tag HG10662-ACR
MAPK6 cDNA ORF Clone, Human, N-OFPSpark® tag HG10662-ANR
MAPK6 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10662-CF
MAPK6 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10662-NF
MAPK6 cDNA ORF Clone, Human, C-His tag HG10662-CH
MAPK6 cDNA ORF Clone, Human, N-His tag HG10662-NH
MAPK6 cDNA ORF Clone, Human, C-HA tag HG10662-CY
MAPK6 cDNA ORF Clone, Human, N-HA tag HG10662-NY
MAPK6 cDNA ORF Clone, Human, N-Myc tag HG10662-NM
MAPK6 qPCR Primer Pairs, Human HP100630
info info
添加购物车成功! 添加购物车失败!