Quick Order

Human ERH Gene ORF cDNA clone expression plasmid, C-Flag tag

DatasheetReviewsRelated ProductsProtocols
Human ERH cDNA Clone Product Information
NCBI RefSeq:BC014301
RefSeq ORF Size:315bp
cDNA Description:Full length Clone DNA of Homo sapiens enhancer of rudimentary homolog (Drosophila) with C terminal Flag tag.
Gene Synonym:DROER
Species:Human
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

ERH(enhancer of rudimentary homolog) belongs to the E(R) family. It is expressed in all tissues examined. The monomeric structure of ERH comprises a single domain consisting of three α-helices and four β-strands, which is a novel fold. In the crystal structure, ERH assumes a dimeric structure, through interactions between the β-sheet regions. The formation of an ERH dimer is consistent with the results of analytical ultracentrifugation. ERH may have a role in the cell cycle. The Drosophila protein ERH is a small protein of 104 amino acids. It has been found to be an enhancer of the rudimentary gene, involved in pyrimidine biosynthesis. From an evolutionary point of view, ERH is highly conserved and has been found to exist in probably all multicellular eukaryotic organisms. ERH interacts with POLDIP3.

References
  • Wojcik E, et al. (1994) The secreted glycoprotein CREG enhances differentiation of NTERA-2 human embryonal carcinoma cells. Oncogene. 19(17):2120-8.
  • Wen SJ, et al. (2003) Screening the proteins that interact with calpain in a human heart cDNA library using a yeast two-hybrid system. Hypertens Res. 25(4):647-52.
  • Gelsthorpe M, et al. (1997) The putative cell cycle gene, enhancer of rudimentary, encodes a highly conserved protein found in plants and animals. Gene. 186(2):189-95.
  • Size / Price
    Catalog: HG14483-CF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"