Epiregulin cDNA ORF Clone, Human, N-HA tag

Cat: HG10677-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Epiregulin Reagents
CRO Services
Product recommended

All Epiregulin Reagents
Epiregulin cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
510 bp
Description
Full length Clone DNA of Human epiregulin with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Epiregulin cDNA ORF Clone, Human, N-HA tag Alternative Names
ER cDNA ORF Clone, Human
Epiregulin Background Information

Epiregulin (EREG) is a member of the epidermal growth factor family. Epiregulin (EREG) can function as a ligand of EGFR (epidermal growth factor receptor), as well as a ligand of most members of the ERBB (v-erb-b2 oncogene homolog) family of tyrosine-kinase receptors. Epiregulin (EREG) exhibit bifunctional regulatory properties: it inhibit the growth of several epithelial tumor cells and stimulated the growth of fibroblasts and various other types of cells. Epiregulin (EREG) bound to the EGF receptors of epidermoid carcinoma A431 cells much more weakly than did EGF, but was nevertheless much more potent than EGF as a mitogen for rat primary hepatocytes and Balb/c 3T3 A31 fibroblasts. These findings suggest that epiregulin (EREG) plays important roles in regulating the growth of epithelial cells and fibroblasts by binding to receptors for EGF-related ligands. Epiregulin (EREG) is the broadest specificity EGF-like ligand so far characterized: not only does it stimulate homodimers of both ErbB-1 and ErbB-4, it also activates all possible heterodimeric ErbB complexes.

Full Name
epiregulin
References
  • Shelly M, et al. (1998) Epiregulin is a potent pan-ErbB ligand that preferentially activates heterodimeric receptor complexes. J Biol Chem. 1998 Apr 24;273(17):10496-505.
  • Shirakata Y, et al. (2000) Epiregulin, a novel member of the epidermal growth factor family, is an autocrine growth factor in normal human keratinocytes. J Biol Chem. 275(8): 5748-53.
  • Zhu Z, et al. (2000) Epiregulin is Up-regulated in pancreatic cancer and stimulates pancreatic cancer cell growth. Biochem Biophys Res Commun. 273(3): 1019-24.
  • Epiregulin cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Epiregulin cDNA ORF Clone in Cloning Vector, Mouse MG50599-M
    Epiregulin cDNA ORF Clone, Mouse, untagged MG50599-UT
    Epiregulin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50599-ACGLN
    Epiregulin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50599-ACG
    Epiregulin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50599-ACR
    Epiregulin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50599-CF
    Epiregulin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50599-NF
    Epiregulin cDNA ORF Clone, Mouse, C-His tag MG50599-CH
    Epiregulin cDNA ORF Clone, Mouse, N-His tag MG50599-NH
    Epiregulin cDNA ORF Clone, Mouse, C-HA tag MG50599-CY
    Epiregulin cDNA ORF Clone, Mouse, N-HA tag MG50599-NY
    Epiregulin cDNA ORF Clone, Mouse, C-Myc tag MG50599-CM
    Epiregulin cDNA ORF Clone, Mouse, N-Myc tag MG50599-NM
    Epiregulin qPCR Primer Pairs, Mouse MP200583

    Epiregulin cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Epiregulin cDNA ORF Clone in Cloning Vector, Human HG10677-M
    Epiregulin cDNA ORF Clone, Human, untagged HG10677-UT
    Epiregulin cDNA ORF Clone, Human, C-GFPSpark® tag HG10677-ACG
    Epiregulin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10677-ACGLN
    Epiregulin cDNA ORF Clone, Human, C-OFPSpark® tag HG10677-ACR
    Epiregulin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10677-CF
    Epiregulin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10677-NF
    Epiregulin cDNA ORF Clone, Human, C-His tag HG10677-CH
    Epiregulin cDNA ORF Clone, Human, N-His tag HG10677-NH
    Epiregulin cDNA ORF Clone, Human, C-HA tag HG10677-CY
    Epiregulin cDNA ORF Clone, Human, C-Myc tag HG10677-CM
    Epiregulin cDNA ORF Clone, Human, N-Myc tag HG10677-NM
    Epiregulin qPCR Primer Pairs, Human HP100642
    info info
    添加购物车成功! 添加购物车失败!