EPS8 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG11153-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All EPS8 Reagents
CRO Services
Product recommended

All EPS8 Reagents
EPS8 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2469 bp
Description
Full length Clone DNA of Human epidermal growth factor receptor pathway substrate 8 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EPS8 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Human EPS8  Gene Expression validated Image 16944
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF02). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
EPS8 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
DFNB102 cDNA ORF Clone, Human
EPS8 Background Information
Full Name
epidermal growth factor receptor pathway substrate 8

EPS8 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
EPS8 cDNA ORF Clone in Cloning Vector, Mouse MG52484-U
EPS8 cDNA ORF Clone, Mouse, untagged MG52484-UT
EPS8 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52484-ACGLN
EPS8 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52484-ACG
EPS8 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52484-ANG
EPS8 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52484-ACR
EPS8 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52484-ANR
EPS8 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52484-CF
EPS8 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52484-NF
EPS8 cDNA ORF Clone, Mouse, C-His tag MG52484-CH
EPS8 cDNA ORF Clone, Mouse, N-His tag MG52484-NH
EPS8 cDNA ORF Clone, Mouse, C-HA tag MG52484-CY
EPS8 cDNA ORF Clone, Mouse, N-HA tag MG52484-NY
EPS8 cDNA ORF Clone, Mouse, C-Myc tag MG52484-CM
EPS8 cDNA ORF Clone, Mouse, N-Myc tag MG52484-NM
EPS8 qPCR Primer Pairs, Mouse MP202357

EPS8 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
EPS8 cDNA ORF Clone in Cloning Vector, Human HG11153-G
EPS8 cDNA ORF Clone, Human, untagged HG11153-UT
EPS8 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11153-ACGLN
EPS8 cDNA ORF Clone, Human, C-GFPSpark® tag HG11153-ACG
EPS8 cDNA ORF Clone, Human, N-GFPSpark® tag HG11153-ANG
EPS8 cDNA ORF Clone, Human, C-OFPSpark® tag HG11153-ACR
EPS8 cDNA ORF Clone, Human, N-OFPSpark® tag HG11153-ANR
EPS8 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11153-NF
EPS8 cDNA ORF Clone, Human, C-His tag HG11153-CH
EPS8 cDNA ORF Clone, Human, N-His tag HG11153-NH
EPS8 cDNA ORF Clone, Human, C-HA tag HG11153-CY
EPS8 cDNA ORF Clone, Human, N-HA tag HG11153-NY
EPS8 cDNA ORF Clone, Human, C-Myc tag HG11153-CM
EPS8 cDNA ORF Clone, Human, N-Myc tag HG11153-NM
EPS8 qPCR Primer Pairs, Human HP101062
info info
添加购物车成功! 添加购物车失败!