Quick Order

Human EphA2/Eph Receptor A2 Gene ORF cDNA clone expression plasmid, C-Flag tag

    DatasheetReviewsRelated ProductsProtocols
    Human EPHA2 cDNA Clone Product Information
    NCBI RefSeq:NM_004431.2
    RefSeq ORF Size:2931bp
    cDNA Description:Full length Clone DNA of Homo sapiens EPH receptor A2 with C terminal Flag tag.
    Gene Synonym:ECK, ARCC2, EPHA2
    Species:Human
    Vector:pCMV3-C-FLAG
    Plasmid:pCMV3-EPHA2-Flag
    Restriction Site:KpnI + XbaI (6kb + 2.97kb)
    Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Sequence Description:Identical with the Gene Bank Ref. ID sequence.
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with EphA2 qPCR primers for gene expression analysis, HP102591 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Product nameProduct name
    Background

    Eph receptor A2 (Ephrin type-A receptor 2 or EphA2) is a member of the ephrin receptor subfamily of the protein-tyrosine kinase family. The Eph receptors' corresponding family of ligands are the ephrins anchored to cell surfaces. The ephrins and Eph receptors are implicated as positional labels that may guide the development of neural topographic maps. They have also been found implicated in embryonic patterning, neuronal targeting, vascular development and adult neovascularization. The large family of ligands and receptors may make a major contribution to the accurate spatial patterning of connections and cell position in the nervous system. Furthermore, elevated expression of Eph receptors and ephrin ligands is associated with tumors and associated tumor vasculature, suggesting the Eph receptors and ephrin ligands also play critical roles in tumor angiogenesis and tumor growth. Unlike most Eph kinases, which are primarily expressed during development, EphA2 is primarily found in adult human epithelial cells. The cellular functions of EphA2 may be regulating cell growth, survival, migration, and angiogenesis.Unlike other receptor tyrosine kinases, ligand binding is not necessary for EphA2. Rather, the ligand appears to regulate EphA2 subcellular localization and its interactions with downstream adapter and signaling proteins. Eph receptor A2(EphA2) has been demonstrated to critically regulate tumor cell growth, migration and invasiveness. Eph receptor A2(EphA2) is frequently overexpressed and functionally altered in aggressive tumor cells, and that these changes promote metastatic character.

    References
  • Flanagan JG, et al. (1998) The ephrins and Eph receptors in neural development. Annu Rev Neurosci. 21: 309-45.
  • Cheng N, et al. (2002) The ephrins and Eph receptors in angiogenesis. Cytokine Growth Factor Rev. 13(1): 75-85.
  • Pratt RL, et al. (2002) Activation of the EphA2 tyrosine kinase stimulates the MAP/ERK kinase signaling cascade. Oncogene. 21(50): 7690-9.
  • Jennifer Walker-Daniels, et al. (2003) Differential Regulation of EphA2 in Normal and Malignant Cells. Am J Pathol. 162(4): 1037-1042.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"