Quick Order

Human EphA1/Eph Receptor A1 Gene ORF cDNA clone expression plasmid, C-His tag

    DatasheetReviewsRelated ProductsProtocols
    Human EPHA1 cDNA Clone Product Information
    NCBI RefSeq:NM_005232.4
    RefSeq ORF Size:2931bp
    cDNA Description:Full length Clone DNA of Homo sapiens EPH receptor A1 with C terminal His tag.
    Gene Synonym:EPH, EPHT, EPHT1
    Species:Human
    Vector:pCMV3-C-His
    Plasmid:
    Restriction Site:
    Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with EPHA1 qPCR primers for gene expression analysis, HP104380 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Product nameProduct name
    Background

    EPHA1 or EPH receptor A1 belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. An important role of Eph receptors and their ligands ephrins is to mediate cell-contact-dependent repulsion. Eph receptors and ephrins also act at boundaries to channel neuronal growth cones along specific pathways, restrict the migration of neural crest cells, and via bidirectional signaling prevent intermingling between hindbrain segments. Eph receptors and ephrins can also trigger an adhesive response of endothelial cells and are required for the remodeling of blood vessels. Eph receptors and ephrins have emerged as key regulators of the repulsion and adhesion of cells that underlie the establishment, maintainence, and remodeling of patterns of cellular organization. The ephrins and Eph receptors are implicated as positional labels that may guide the development of neural topographic maps.

    References
  • Flanagan JG, et al. (1998) THE EPHRINS AND EPH RECEPTORS IN NEURAL DEVELOPMENT. Annual Review of Neuroscience. 21: 309-45.
  • Wilkinson DG (2000) Eph receptors and ephrins: Regulators of guidance and assembly. International Review of Cytology. 196: 177-244.
  • Zhou R. (1998) The Eph family receptors and ligands. Pharmacol. 77 (3): 151-81.
  • Size / Price
    Catalog: HG15789-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"