Quick Order

Human EPDR1 Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human EPDR1 cDNA Clone Product Information
NCBI RefSeq:BC018299
RefSeq ORF Size:675bp
cDNA Description:Full length Clone DNA of Homo sapiens ependymin related protein 1 (zebrafish) with N terminal His tag.
Gene Synonym:EPDR, UCC1, MERP1, MERP-1, EPDR1
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

EPDR1 is a member of the ependymin family. EPDR1 is a type II transmembrane protein that is similar to two families of cell adhesion molecules, the protocadherins and ependymins. It may play a role in calcium-dependent cell adhesion. EPDR1 is glycosylated, and the orthologous mouse protein is localized to the lysosome. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 8.

References
  • Suga T. et al., 2008, Int J Radiat Oncol Biol Phys. 72 (3): 808-13.
  • Rose JE. et al., 2010, Mol Med. 16 (7-8): 247-53.
  • Cheng W. et al., 2010, J Huazhong Univ Sci Technolog Med Sci. 30 (3): 391-6.
  • Size / Price
    Catalog: HG13665-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"