ENSA cDNA ORF Clone, Human, N-His tag

Cat: HG14321-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ENSA Reagents
CRO Services
Product recommended

All ENSA Reagents
ENSA cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
366 bp
Description
Full length Clone DNA of Human endosulfine alpha with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ENSA cDNA ORF Clone, Human, N-His tag Alternative Names
ARPP-19e cDNA ORF Clone, Human
ENSA Background Information

Endosulfine alpha, also known as ENSA, belongs to the endosulfine family. It is a highly conserved cAMP-regulated phosphoprotein (ARPP) family. Endosulfine alpha is widely expressed with high levels in skeletal muscle and brain and lower levels in the pancreas. As a protein phosphatase inhibitor, ENSA specifically inhibits protein phosphatase 2A (PP2A) during mitosis. When phosphorylated at Ser-67 during mitosis, specifically interacts with PPP2R2D (PR55-delta) and inhibits its activity, leading to inactivation of PP2A, an essential condition to keep cyclin-B1-CDK1 activity high during M phase By similarity. Endosulfine alpha also acts as a stimulator of insulin secretion by interacting with sulfonylurea receptor (ABCC8), thereby preventing sulfonylurea from binding to its receptor and reducing K(ATP) channel currents.

Full Name
endosulfine alpha
References
  • Ye M. et al., 2001, Genome Res. 10 (10): 1546-60.
  • Apiou F. et al., 1999, Diabetes 48 (9): 1873-6.
  • Lennon G. et al., 1997, Genome Res. 6 (9): 791-806.
  • ENSA cDNA ORF Clone, Cynomolgus, Related Products

    Product Name Catalog#(PDF)
    ENSA cDNA ORF Clone in Cloning Vector, Cynomolgus CG90656-G
    ENSA cDNA ORF Clone, Cynomolgus, untagged CG90656-UT
    ENSA cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90656-ACG
    ENSA Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90656-ACGLN
    ENSA cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90656-ANG
    ENSA cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90656-ACR
    ENSA cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90656-ANR
    ENSA cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90656-CF
    ENSA cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90656-NF
    ENSA cDNA ORF Clone, Cynomolgus, C-His tag CG90656-CH
    ENSA cDNA ORF Clone, Cynomolgus, N-His tag CG90656-NH
    ENSA cDNA ORF Clone, Cynomolgus, C-HA tag CG90656-CY
    ENSA cDNA ORF Clone, Cynomolgus, N-HA tag CG90656-NY
    ENSA cDNA ORF Clone, Cynomolgus, C-Myc tag CG90656-CM
    ENSA cDNA ORF Clone, Cynomolgus, N-Myc tag CG90656-NM

    ENSA cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    ENSA cDNA ORF Clone in Cloning Vector, Rat RG83740-U
    ENSA Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG83740-ACGLN

    ENSA cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    ENSA cDNA ORF Clone in Cloning Vector, Human HG14321-G
    ENSA cDNA ORF Clone, Human, untagged HG14321-UT
    ENSA cDNA ORF Clone, Human, C-GFPSpark® tag HG14321-ACG
    ENSA Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14321-ACGLN
    ENSA cDNA ORF Clone, Human, N-GFPSpark® tag HG14321-ANG
    ENSA cDNA ORF Clone, Human, C-OFPSpark® tag HG14321-ACR
    ENSA cDNA ORF Clone, Human, N-OFPSpark® tag HG14321-ANR
    ENSA cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14321-CF
    ENSA cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14321-NF
    ENSA cDNA ORF Clone, Human, C-His tag HG14321-CH
    ENSA cDNA ORF Clone, Human, C-HA tag HG14321-CY
    ENSA cDNA ORF Clone, Human, N-HA tag HG14321-NY
    ENSA cDNA ORF Clone, Human, C-Myc tag HG14321-CM
    ENSA cDNA ORF Clone, Human, N-Myc tag HG14321-NM
    ENSA qPCR Primer Pairs, Human HP102971
    info info
    添加购物车成功! 添加购物车失败!