After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human ENSA / Endosulfine alpha Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human ENSA cDNA Clone Product Information
NCBI RefSeq:BC000436
RefSeq ORF Size:366bp
cDNA Description:Full length Clone DNA of Homo sapiens endosulfine alpha.
Gene Synonym:RP11-54A4.10-004, ARPP-19e, MGC4319, MGC78563, MGC8394, ENSA
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Endosulfine alpha, also known as ENSA, belongs to the endosulfine family. It is a highly conserved cAMP-regulated phosphoprotein (ARPP) family. Endosulfine alpha is widely expressed with high levels in skeletal muscle and brain and lower levels in the pancreas. As a protein phosphatase inhibitor, ENSA specifically inhibits protein phosphatase 2A (PP2A) during mitosis. When phosphorylated at Ser-67 during mitosis, specifically interacts with PPP2R2D (PR55-delta) and inhibits its activity, leading to inactivation of PP2A, an essential condition to keep cyclin-B1-CDK1 activity high during M phase By similarity. Endosulfine alpha also acts as a stimulator of insulin secretion by interacting with sulfonylurea receptor (ABCC8), thereby preventing sulfonylurea from binding to its receptor and reducing K(ATP) channel currents.

References
  • Ye M. et al., 2001, Genome Res. 10 (10): 1546-60.
  • Apiou F. et al., 1999, Diabetes 48 (9): 1873-6.
  • Lennon G. et al., 1997, Genome Res. 6 (9): 791-806.
  • Size / Price
    Catalog: HG14321-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"