ENPP-5 cDNA ORF Clone, Human, N-His tag

Cat: HG11519-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All ENPP-5 Reagents
CRO Services
Product recommended

All ENPP-5 Reagents
ENPP-5 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1434 bp
Description
Full length Clone DNA of Human ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative function) with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ENPP-5 cDNA ORF Clone, Human, N-His tag Alternative Names
NPP-5 cDNA ORF Clone, Human
ENPP-5 Background Information

ENPP5 is a member of the nucleotide pyrophosphatase/phosphodiesterase family(NPP). It is a family comprised by dimeric enzymes that catalyze the hydrolysis of phosphate diester bonds. There are seven isoforms in NPP family, some of which prefer nucleotide substrates, some of which prefer phospholipid substrates, and others of which prefer substrates that have not yet been determined. NPP also belongs to the alkaline phosphatase (AP) superfamily of enzymes and they are located in the cell membrane and hydrolyze extracellular phosphate diesters to affect a wide variety of biological processes. ENPP5 belongs to a group of nucleotidemetabolizing ectoenzymes, which regulate the availability of extracellular nucleotides. ENPP5 may play a role in neuronal cell communication. Hhowever, it lacks nucleotide pyrophosphatase and lysopholipase D activity. It may also be involved in neuronal cell communication. The amino acid sequence of human ENPP5 is 100%, 88%, and 82% identical to that of chimpanzee, dog and mouse/rat. ENPP5 functions in phospholipid metabolism.

Full Name
ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative)
References
  • Strausberg RL, et al. (2002) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Gerhard DS, et al. (2004) The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). Genome Res. 14(10B):2121-7.
  • Lamesch P, et al. (2007) hORFeome v3.1: a resource of human open reading frames representing over 10,000 human genes. Genomics. 89(3):307-15.
  • info info
    添加购物车成功! 添加购物车失败!